Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007012 Pseudomonas sp. FGI182 chromosome, complete genome 3 crisprs DEDDh,cas3,WYL,DinG,csa3,c2c9_V-U4 1 0 5 0

Results visualization

1. NZ_CP007012
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007012_1 2864700-2864780 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007012_2 3953452-3953542 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007012_3 4175182-4175274 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP007012_3 3.1|4175213|31|NZ_CP007012|CRISPRCasFinder 4175213-4175243 31 NZ_CP007012.1 828928-828958 1 0.968

1. spacer 3.1|4175213|31|NZ_CP007012|CRISPRCasFinder matches to position: 828928-828958, mismatch: 1, identity: 0.968

tgttcgccttgacgctttctgcgcctgtgaa	CRISPR spacer
tgttcgccttgacactttctgcgcctgtgaa	Protospacer
*************.*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 264419 : 331722 57 Bacillus_phage(25.0%) holin,protease,integrase attL 293579:293623|attR 323430:323474
DBSCAN-SWA_2 1024481 : 1032260 10 Thermobifida_phage(16.67%) NA NA
DBSCAN-SWA_3 1478690 : 1490031 7 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_4 3622002 : 3711794 91 uncultured_Caudovirales_phage(35.29%) portal,lysis,protease,terminase,tRNA,tail,head,plate,holin,capsid NA
DBSCAN-SWA_5 3874140 : 3941048 59 Pseudomonas_virus(33.33%) transposase,head,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage