Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006579 Aeromonas hydrophila 4AK4 chromosome, complete genome 23 crisprs WYL,DinG,csa3,DEDDh,cas3 0 1 4 0

Results visualization

1. NZ_CP006579
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_1 301593-301699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_2 308959-309060 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_3 398287-398411 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_4 408074-408197 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_5 437087-437198 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_6 485649-485752 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_7 758997-759077 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_8 965467-965578 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_9 1080631-1080738 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_10 1170310-1170394 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_11 1326933-1327043 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_12 1545860-1545950 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_13 1611508-1611641 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_14 1674870-1674965 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_15 1923755-1923892 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_16 2142753-2142882 Orphan NA
1 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_17 2480229-2480302 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_18 2751984-2752074 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_19 2999442-2999561 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_20 3290955-3291072 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_21 3849502-3849613 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_22 3871173-3871274 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006579_23 4359542-4359650 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006579_10 10.1|1170337|31|NZ_CP006579|CRISPRCasFinder 1170337-1170367 31 MH576962 Streptomyces phage Satis, complete genome 74373-74403 4 0.871
NZ_CP006579_10 10.1|1170337|31|NZ_CP006579|CRISPRCasFinder 1170337-1170367 31 MK620894 Streptomyces phage Kradal, complete genome 74377-74407 4 0.871
NZ_CP006579_10 10.1|1170337|31|NZ_CP006579|CRISPRCasFinder 1170337-1170367 31 NC_024123 Pseudomonas phage KPP25 DNA, complete sequence 43912-43942 8 0.742

1. spacer 10.1|1170337|31|NZ_CP006579|CRISPRCasFinder matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 4, identity: 0.871

-cggtccgcgtcttcttctggtgcgggttgtg	CRISPR spacer
acggcccg-gtcttcttctcgcgcgggttgtg	Protospacer
 ***.*** ********** *.**********

2. spacer 10.1|1170337|31|NZ_CP006579|CRISPRCasFinder matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 4, identity: 0.871

-cggtccgcgtcttcttctggtgcgggttgtg	CRISPR spacer
acggcccg-gtcttcttctcgcgcgggttgtg	Protospacer
 ***.*** ********** *.**********

3. spacer 10.1|1170337|31|NZ_CP006579|CRISPRCasFinder matches to NC_024123 (Pseudomonas phage KPP25 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

cggtccgcgtcttcttctggtgcgggttgtg	CRISPR spacer
tcttcagcgtcttcttctggtgcggcatcag	Protospacer
.  ** *******************  *  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1024822 : 1034129 8 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 2255218 : 2266338 8 Hokovirus(16.67%) tRNA NA
DBSCAN-SWA_3 2754990 : 2803269 64 Salmonella_phage(23.81%) portal,tail,lysis,integrase,tRNA,terminase,head,plate,capsid,holin attL 2762421:2762439|attR 2804696:2804714
DBSCAN-SWA_4 3750984 : 3760960 10 uncultured_Mediterranean_phage(25.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage