Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006715 Bifidobacterium breve 689b, complete genome 2 crisprs cas3,WYL 1 1 0 0

Results visualization

1. NZ_CP006715
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006715_1 1457109-1457202 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006715_2 2078792-2078938 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP006715_2 2.1|2078817|36|NZ_CP006715|CRISPRCasFinder 2078817-2078852 36 NZ_CP006715.1 2080154-2080189 2 0.944

1. spacer 2.1|2078817|36|NZ_CP006715|CRISPRCasFinder matches to position: 2080154-2080189, mismatch: 2, identity: 0.944

tcaaagccagtgacagaaatttaggaaatcaacccc	CRISPR spacer
tcaaagccaatgacagatatttaggaaatcaacccc	Protospacer
*********.******* ******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MG878892 Salmonella phage vB_SpuP_Spp16, complete genome 34705-34732 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MK448960 Streptococcus phage Javan492, complete genome 7017-7044 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MK448762 Streptococcus phage Javan447, complete genome 7143-7170 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MK448795 Streptococcus phage Javan527, complete genome 12700-12727 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 NC_028700 Streptococcus phage T12, complete genome 6980-7007 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MK448790 Streptococcus phage Javan515, complete genome 7430-7457 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MK448954 Streptococcus phage Javan476, complete genome 7098-7125 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MK448950 Streptococcus phage Javan464, complete genome 7026-7053 6 0.786
NZ_CP006715_1 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder 1457142-1457169 28 MK448683 Streptococcus phage Javan149, complete genome 8908-8935 6 0.786

1. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MG878892 (Salmonella phage vB_SpuP_Spp16, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
tagctactgagttactgtcagctaaagt	Protospacer
. *..***************** * ***

2. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MK448960 (Streptococcus phage Javan492, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

3. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MK448762 (Streptococcus phage Javan447, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

4. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

5. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to NC_028700 (Streptococcus phage T12, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

6. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MK448790 (Streptococcus phage Javan515, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

7. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

8. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

9. spacer 1.1|1457142|28|NZ_CP006715|CRISPRCasFinder matches to MK448683 (Streptococcus phage Javan149, complete genome) position: , mismatch: 6, identity: 0.786

ctgtcactgagttactgtcagcgacagt	CRISPR spacer
atgtcactgacttactgtcagagataaa	Protospacer
 ********* ********** **.*. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage