Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006829 Thalassolituus oleivorans R6-15, complete genome 3 crisprs cas3,csa3,DEDDh,WYL,DinG,RT 1 0 3 0

Results visualization

1. NZ_CP006829
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006829_1 418993-419102 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006829_2 2257529-2257678 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006829_3 2508225-2508335 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP006829_1 1.1|419022|52|NZ_CP006829|CRISPRCasFinder 419022-419073 52 NZ_CP006829.1 424965-425016 2 0.962

1. spacer 1.1|419022|52|NZ_CP006829|CRISPRCasFinder matches to position: 424965-425016, mismatch: 2, identity: 0.962

cctagttggctacttctctagtagtaccattaatagtagtttcgctactggt	CRISPR spacer
cctagttggctactcatctagtagtaccattaatagtagtttcgctactggt	Protospacer
**************. ************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 333653 : 398187 51 Diadromus_pulchellus_ascovirus(14.29%) plate,transposase,tRNA NA
DBSCAN-SWA_2 1441878 : 1451565 12 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_3 1841885 : 1850580 10 uncultured_Caudovirales_phage(66.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage