Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_022906 Brucella ceti TE10759-12 chromosome 2, complete sequence 2 crisprs DEDDh,csa3,cas3 0 0 0 0
NC_022905 Brucella ceti TE10759-12 chromosome 1, complete sequence 1 crisprs WYL,csa3,DEDDh 0 1 3 0

Results visualization

1. NC_022905
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022905_1 1349860-1349942 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_022905_1 1.1|1349888|27|NC_022905|CRISPRCasFinder 1349888-1349914 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|1349888|27|NC_022905|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1041488 : 1049841 11 Brucella_phage(28.57%) transposase NA
DBSCAN-SWA_2 1120655 : 1132582 13 uncultured_Mediterranean_phage(80.0%) tRNA NA
DBSCAN-SWA_3 1359044 : 1462962 96 Paenibacillus_phage(13.04%) portal,tail,holin,transposase,integrase,protease attL 1354573:1354589|attR 1437574:1437590
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_022906
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022906_1 286110-286210 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_022906_2 1030976-1031093 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage