Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010804 Candidatus Liberibacter asiaticus strain A4 chromosome, complete genome 2 crisprs DEDDh,cas3 0 1 1 0

Results visualization

1. NZ_CP010804
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010804_1 204424-204554 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010804_2 1219364-1219451 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 KX879602 Liberibacter phage HHCA1-2, complete genome 22504-22535 0 1.0
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 HQ377372 Liberibacter phage SC1, complete genome 27015-27046 0 1.0
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 JF773396 Liberibacter phage FP2, complete genome 27655-27686 0 1.0
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 NC_019550 Liberibacter phage SC2, complete genome 22485-22516 0 1.0
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 KY661963 Liberibacter phage P-JXGC-3, complete genome 18455-18486 0 1.0
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 HQ377372 Liberibacter phage SC1, complete genome 33586-33617 3 0.906
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 JF773396 Liberibacter phage FP2, complete genome 34246-34277 3 0.906
NZ_CP010804_2 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder 1219392-1219423 32 NC_019550 Liberibacter phage SC2, complete genome 29076-29107 3 0.906

1. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to KX879602 (Liberibacter phage HHCA1-2, complete genome) position: , mismatch: 0, identity: 1.0

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tggcaaaacaccacccccttaagactgaaggc	Protospacer
********************************

2. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to HQ377372 (Liberibacter phage SC1, complete genome) position: , mismatch: 0, identity: 1.0

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tggcaaaacaccacccccttaagactgaaggc	Protospacer
********************************

3. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to JF773396 (Liberibacter phage FP2, complete genome) position: , mismatch: 0, identity: 1.0

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tggcaaaacaccacccccttaagactgaaggc	Protospacer
********************************

4. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to NC_019550 (Liberibacter phage SC2, complete genome) position: , mismatch: 0, identity: 1.0

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tggcaaaacaccacccccttaagactgaaggc	Protospacer
********************************

5. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to KY661963 (Liberibacter phage P-JXGC-3, complete genome) position: , mismatch: 0, identity: 1.0

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tggcaaaacaccacccccttaagactgaaggc	Protospacer
********************************

6. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to HQ377372 (Liberibacter phage SC1, complete genome) position: , mismatch: 3, identity: 0.906

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tagcaaaacgctacccccttaagactgaaggc	Protospacer
*.*******.*.********************

7. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to JF773396 (Liberibacter phage FP2, complete genome) position: , mismatch: 3, identity: 0.906

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tagcaaaacgctacccccttaagactgaaggc	Protospacer
*.*******.*.********************

8. spacer 2.1|1219392|32|NZ_CP010804|CRISPRCasFinder matches to NC_019550 (Liberibacter phage SC2, complete genome) position: , mismatch: 3, identity: 0.906

tggcaaaacaccacccccttaagactgaaggc	CRISPR spacer
tagcaaaacgctacccccttaagactgaaggc	Protospacer
*.*******.*.********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1187149 : 1229591 46 Liberibacter_phage(100.0%) head,terminase,tail,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage