Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006823 Helicobacter pylori oki154 chromosome, complete genome 3 crisprs cas14j,cas3,DEDDh 0 1 0 0

Results visualization

1. NZ_CP006823
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006823_1 126280-126366 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006823_2 377586-377660 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006823_3 500134-500231 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006823_2 2.1|377609|29|NZ_CP006823|CRISPRCasFinder 377609-377637 29 NZ_CP017574 Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence 336463-336491 6 0.793

1. spacer 2.1|377609|29|NZ_CP006823|CRISPRCasFinder matches to NZ_CP017574 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG364, complete sequence) position: , mismatch: 6, identity: 0.793

attatcaatccgctacttttatatcacat	CRISPR spacer
cttatcaatccgcttcttctatatagaat	Protospacer
 ************* ***.***** . **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage