Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007444 Dyella jiangningensis strain SBZ 3-12, complete genome 3 crisprs csa3,DEDDh,DinG,cas3,WYL 0 1 4 0

Results visualization

1. NZ_CP007444
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007444_1 1192527-1192609 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007444_2 1240115-1240220 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007444_3 4098736-4098822 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007444_3 3.1|4098763|33|NZ_CP007444|CRISPRCasFinder 4098763-4098795 33 MF580956 Salinibacter virus M8CC-19, complete genome 44263-44295 8 0.758
NZ_CP007444_3 3.1|4098763|33|NZ_CP007444|CRISPRCasFinder 4098763-4098795 33 MF580960 Salinibacter virus M31CC-1, partial genome 44260-44292 8 0.758

1. spacer 3.1|4098763|33|NZ_CP007444|CRISPRCasFinder matches to MF580956 (Salinibacter virus M8CC-19, complete genome) position: , mismatch: 8, identity: 0.758

cacagaaaagcagcggcgtgaagcctggcgcga	CRISPR spacer
cacagaaaagcagcgccgcgaagcccaccttgc	Protospacer
*************** **.******.. * .* 

2. spacer 3.1|4098763|33|NZ_CP007444|CRISPRCasFinder matches to MF580960 (Salinibacter virus M31CC-1, partial genome) position: , mismatch: 8, identity: 0.758

cacagaaaagcagcggcgtgaagcctggcgcga	CRISPR spacer
cacagaaaagcagcgccgcgaagcccaccttgc	Protospacer
*************** **.******.. * .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 214572 : 224298 9 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_2 1348108 : 1353908 11 Erythrobacter_phage(14.29%) NA NA
DBSCAN-SWA_3 1359257 : 1385067 38 Burkholderia_phage(44.44%) head NA
DBSCAN-SWA_4 5266576 : 5276302 9 Escherichia_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage