Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007604 Helicobacter pylori strain BM013A chromosome, complete genome 4 crisprs cas3,cas2,c2c9_V-U4,DEDDh 0 4 1 0

Results visualization

1. NZ_CP007604
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007604_1 337628-337749 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007604_2 339197-339327 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007604_3 853272-853368 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007604_4 894384-894582 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007604_4 4.3|894529|26|NZ_CP007604|CRISPRCasFinder 894529-894554 26 NZ_CP022727 Erwinia persicina strain B64 plasmid pEP2, complete sequence 67406-67431 2 0.923
NZ_CP007604_4 4.2|894472|29|NZ_CP007604|CRISPRCasFinder 894472-894500 29 U88974 Streptococcus thermophilus temperate bacteriophage O1205, complete genome 23172-23200 5 0.828
NZ_CP007604_4 4.2|894472|29|NZ_CP007604|CRISPRCasFinder 894472-894500 29 NC_004303 Streptococcus phage O1205, complete genome 23172-23200 5 0.828
NZ_CP007604_4 4.3|894529|26|NZ_CP007604|CRISPRCasFinder 894529-894554 26 NZ_CP034186 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence 116561-116586 5 0.808
NZ_CP007604_4 4.5|894470|34|NZ_CP007604|PILER-CR 894470-894503 34 MK448589 Streptococcus satellite phage Javan632, complete genome 4589-4622 7 0.794
NZ_CP007604_4 4.5|894470|34|NZ_CP007604|PILER-CR 894470-894503 34 U88974 Streptococcus thermophilus temperate bacteriophage O1205, complete genome 23169-23202 9 0.735
NZ_CP007604_4 4.5|894470|34|NZ_CP007604|PILER-CR 894470-894503 34 NC_004303 Streptococcus phage O1205, complete genome 23169-23202 9 0.735
NZ_CP007604_4 4.6|894527|36|NZ_CP007604|PILER-CR 894527-894562 36 NZ_CP022727 Erwinia persicina strain B64 plasmid pEP2, complete sequence 67399-67434 10 0.722

1. spacer 4.3|894529|26|NZ_CP007604|CRISPRCasFinder matches to NZ_CP022727 (Erwinia persicina strain B64 plasmid pEP2, complete sequence) position: , mismatch: 2, identity: 0.923

atggcaacgccagctttaataacgac	CRISPR spacer
atggcaacgccagcgttaataccgac	Protospacer
************** ****** ****

2. spacer 4.2|894472|29|NZ_CP007604|CRISPRCasFinder matches to U88974 (Streptococcus thermophilus temperate bacteriophage O1205, complete genome) position: , mismatch: 5, identity: 0.828

atagcgcccaatccacttttgaaaacagc	CRISPR spacer
ttagcgcccaaaacacttttgaaaactga	Protospacer
 **********  ************* * 

3. spacer 4.2|894472|29|NZ_CP007604|CRISPRCasFinder matches to NC_004303 (Streptococcus phage O1205, complete genome) position: , mismatch: 5, identity: 0.828

atagcgcccaatccacttttgaaaacagc	CRISPR spacer
ttagcgcccaaaacacttttgaaaactga	Protospacer
 **********  ************* * 

4. spacer 4.3|894529|26|NZ_CP007604|CRISPRCasFinder matches to NZ_CP034186 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

atggcaacgccagctttaataacgac	CRISPR spacer
ccggcagccccagctttaataacgaa	Protospacer
 .****.* **************** 

5. spacer 4.5|894470|34|NZ_CP007604|PILER-CR matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 7, identity: 0.794

taatagcgc-ccaatccacttttgaaaacagcaat	CRISPR spacer
-aaaaccgtaccaatcgccttttgaaaacagcaag	Protospacer
 ** * **. ******  **************** 

6. spacer 4.5|894470|34|NZ_CP007604|PILER-CR matches to U88974 (Streptococcus thermophilus temperate bacteriophage O1205, complete genome) position: , mismatch: 9, identity: 0.735

taatagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
aattagcgcccaaaacacttttgaaaactgatcc	Protospacer
 * **********  ************* *   .

7. spacer 4.5|894470|34|NZ_CP007604|PILER-CR matches to NC_004303 (Streptococcus phage O1205, complete genome) position: , mismatch: 9, identity: 0.735

taatagcgcccaatccacttttgaaaacagcaat	CRISPR spacer
aattagcgcccaaaacacttttgaaaactgatcc	Protospacer
 * **********  ************* *   .

8. spacer 4.6|894527|36|NZ_CP007604|PILER-CR matches to NZ_CP022727 (Erwinia persicina strain B64 plasmid pEP2, complete sequence) position: , mismatch: 10, identity: 0.722

aattttaatggcaacgccagctttaataacgacact	CRISPR spacer
gacgaagatggcaacgccagcgttaataccgacagc	Protospacer
.*.   .************** ****** ***** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1443059 : 1511511 55 Helicobacter_phage(30.77%) transposase,tRNA,integrase attL 1504724:1504783|attR 1512926:1514960
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage