Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007564 Borreliella garinii SZ chromosome, complete genome 2 crisprs NA 0 1 1 0

Results visualization

1. NZ_CP007564
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007564_1 131143-131291 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007564_2 743763-743862 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007564_1 1.2|131238|31|NZ_CP007564|CRISPRCasFinder 131238-131268 31 NC_017257 Buchnera aphidicola str. Ak (Acyrthosiphon kondoi) plasmid pLeu, complete sequence 7642-7672 8 0.742
NZ_CP007564_1 1.2|131238|31|NZ_CP007564|CRISPRCasFinder 131238-131268 31 NZ_CP018752 Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed5 11076-11106 8 0.742
NZ_CP007564_1 1.2|131238|31|NZ_CP007564|CRISPRCasFinder 131238-131268 31 NZ_CP028871 Borreliella garinii strain 20047 plasmid lp32-10, complete sequence 12105-12135 8 0.742
NZ_CP007564_1 1.2|131238|31|NZ_CP007564|CRISPRCasFinder 131238-131268 31 MK614706 Gammaproteobacteria virus GOV_bin_2604, complete genome 53551-53581 9 0.71
NZ_CP007564_1 1.2|131238|31|NZ_CP007564|CRISPRCasFinder 131238-131268 31 MK448941 Streptococcus phage Javan446, complete genome 10097-10127 10 0.677

1. spacer 1.2|131238|31|NZ_CP007564|CRISPRCasFinder matches to NC_017257 (Buchnera aphidicola str. Ak (Acyrthosiphon kondoi) plasmid pLeu, complete sequence) position: , mismatch: 8, identity: 0.742

aaacaaaaataataacaatgatcttgagaac	CRISPR spacer
aaacaaaaataataagaatcatctaattcaa	Protospacer
*************** *** **** .   * 

2. spacer 1.2|131238|31|NZ_CP007564|CRISPRCasFinder matches to NZ_CP018752 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed5) position: , mismatch: 8, identity: 0.742

aaacaaaaataataacaatgatcttgagaac	CRISPR spacer
taacaaatataataacaatgacctcatttac	Protospacer
 ****** *************.**..   **

3. spacer 1.2|131238|31|NZ_CP007564|CRISPRCasFinder matches to NZ_CP028871 (Borreliella garinii strain 20047 plasmid lp32-10, complete sequence) position: , mismatch: 8, identity: 0.742

aaacaaaaataataacaatgatcttgagaac	CRISPR spacer
taacaaatataataacaatgacctcatttac	Protospacer
 ****** *************.**..   **

4. spacer 1.2|131238|31|NZ_CP007564|CRISPRCasFinder matches to MK614706 (Gammaproteobacteria virus GOV_bin_2604, complete genome) position: , mismatch: 9, identity: 0.71

aaacaaaaataataacaatgatcttgagaac	CRISPR spacer
gttctgtaataataaatatgatcttgagaaa	Protospacer
.  * . ********  ************* 

5. spacer 1.2|131238|31|NZ_CP007564|CRISPRCasFinder matches to MK448941 (Streptococcus phage Javan446, complete genome) position: , mismatch: 10, identity: 0.677

aaacaaaaataataacaatgatcttgagaac	CRISPR spacer
ttgcaaaaataataccaatgattttgtaggt	Protospacer
  .*********** *******.*** ....

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 446923 : 456362 9 Bacillus_virus(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage