Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007799 Escherichia coli Nissle 1917 chromosome, complete genome 4 crisprs cas14j,DinG,cas3,DEDDh,csa3,c2c9_V-U4,WYL 1 2 7 0

Results visualization

1. NZ_CP007799
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007799_1 2606114-2606227 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007799_2 4968147-4968293 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007799_3 5051059-5051193 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007799_4 5298264-5298355 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP007799_4 4.1|5298290|40|NZ_CP007799|CRISPRCasFinder 5298290-5298329 40 NZ_CP007799.1 1074504-1074543 0 1.0

1. spacer 4.1|5298290|40|NZ_CP007799|CRISPRCasFinder matches to position: 1074504-1074543, mismatch: 0, identity: 1.0

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcatttttgaaattacccccgctgtgctgt	Protospacer
****************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007799_3 3.1|5051105|43|NZ_CP007799|CRISPRCasFinder 5051105-5051147 43 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 69640-69682 0 1.0
NZ_CP007799_4 4.1|5298290|40|NZ_CP007799|CRISPRCasFinder 5298290-5298329 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975

1. spacer 3.1|5051105|43|NZ_CP007799|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

aggcagcatccggcagtcggcgcataatgcctgatgcgacgct	CRISPR spacer
aggcagcatccggcagtcggcgcataatgcctgatgcgacgct	Protospacer
*******************************************

2. spacer 4.1|5298290|40|NZ_CP007799|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1316980 : 1372236 67 Enterobacteria_phage(57.41%) lysis,transposase,tail,portal,head,capsid,tRNA,terminase,integrase attL 1313368:1313382|attR 1341860:1341874
DBSCAN-SWA_2 1995679 : 2089511 103 Enterobacteria_phage(25.81%) protease,tail,holin,portal,tRNA,terminase NA
DBSCAN-SWA_3 2471724 : 2481169 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_4 3072570 : 3079710 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_5 3312618 : 3367727 48 Acinetobacter_phage(28.57%) lysis,protease,transposase,tRNA,integrase attL 3332556:3332571|attR 3346697:3346712
DBSCAN-SWA_6 3404902 : 3415468 18 Pseudomonas_phage(36.36%) NA NA
DBSCAN-SWA_7 5252658 : 5353742 53 Enterobacteria_phage(22.22%) integrase,tRNA,transposase attL 5244888:5244922|attR 5378228:5378262
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage