Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP008797 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 chromosome, complete genome 2 crisprs cas3,csa3,DEDDh,RT,DinG,WYL 0 1 11 0
NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 0 crisprs cas3,csa3,RT 0 0 1 0
NZ_CP008798 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPC-484, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP008799 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-819, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP008797
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008797_1 812999-813084 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008797_2 4614840-4614935 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP008797_2 2.1|4614870|36|NZ_CP008797|CRISPRCasFinder 4614870-4614905 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP008797_2 2.1|4614870|36|NZ_CP008797|CRISPRCasFinder 4614870-4614905 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP008797_2 2.1|4614870|36|NZ_CP008797|CRISPRCasFinder 4614870-4614905 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|4614870|36|NZ_CP008797|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 2.1|4614870|36|NZ_CP008797|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 2.1|4614870|36|NZ_CP008797|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 590779 : 596604 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_2 961972 : 1067038 102 uncultured_Caudovirales_phage(54.55%) head,capsid,portal,terminase,tRNA,integrase,tail,protease attL 1015268:1015285|attR 1031263:1031280
DBSCAN-SWA_3 2218418 : 2225325 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_4 2506869 : 2563509 55 Staphylococcus_phage(15.38%) plate,transposase,protease NA
DBSCAN-SWA_5 3232496 : 3243383 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_6 3436876 : 3619750 199 Klebsiella_phage(22.94%) lysis,plate,terminase,holin,integrase,tail,transposase attL 3487998:3488015|attR 3619471:3619486
DBSCAN-SWA_7 3908716 : 3924796 14 Salmonella_phage(50.0%) holin NA
DBSCAN-SWA_8 3929912 : 3952568 33 Pectobacterium_phage(28.57%) integrase,head,tail attL 3920692:3920706|attR 3953652:3953666
DBSCAN-SWA_9 4040217 : 4133168 94 Salmonella_phage(58.62%) head,lysis,integrase,plate,portal,terminase,tRNA,capsid,tail,protease attL 4095743:4095761|attR 4133243:4133261
DBSCAN-SWA_10 4579584 : 4625960 66 Cronobacter_phage(24.53%) head,lysis,holin,tRNA,transposase NA
DBSCAN-SWA_11 4835515 : 4847169 13 Enterobacteria_phage(70.0%) integrase attL 4835965:4835979|attR 4859022:4859036
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP008799
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 23028 : 45571 19 Escherichia_phage(66.67%) transposase,lysis NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP008798
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2033 : 71903 61 Escherichia_phage(41.94%) transposase,integrase attL 43698:43757|attR 62336:63155
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP008800
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26876 : 71067 37 Salmonella_phage(20.0%) transposase,protease,integrase attL 45002:45061|attR 59972:61171
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage