Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007139 Fimbriimonas ginsengisoli Gsoil 348 chromosome, complete genome 3 crisprs csa3,PD-DExK,WYL,DinG,cas3,Cas9_archaeal 0 1 0 0

Results visualization

1. NZ_CP007139
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007139_1 919793-919933 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007139_2 1430833-1430922 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007139_3 2136578-2136660 TypeI-A NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007139_1 1.1|919847|33|NZ_CP007139|CRISPRCasFinder 919847-919879 33 CP000621 Burkholderia vietnamiensis G4 plasmid pBVIE05, complete sequence 82719-82751 8 0.758
NZ_CP007139_1 1.1|919847|33|NZ_CP007139|CRISPRCasFinder 919847-919879 33 NZ_AP015032 Pseudomonas putida strain KF715 plasmid pKF715C, complete sequence 93865-93897 9 0.727

1. spacer 1.1|919847|33|NZ_CP007139|CRISPRCasFinder matches to CP000621 (Burkholderia vietnamiensis G4 plasmid pBVIE05, complete sequence) position: , mismatch: 8, identity: 0.758

ggagggtgctggtgtcctcaggcggaggaacgc	CRISPR spacer
agagggcgcgggtgtcctcaggcggccgcctgc	Protospacer
.*****.** ***************  *  .**

2. spacer 1.1|919847|33|NZ_CP007139|CRISPRCasFinder matches to NZ_AP015032 (Pseudomonas putida strain KF715 plasmid pKF715C, complete sequence) position: , mismatch: 9, identity: 0.727

ggagggtgctggtgtcctcaggcggaggaacgc	CRISPR spacer
ggagggtgctggtgtcctggggcgcgcgcatca	Protospacer
****************** .**** . * *.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage