Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP036550 Bacteroides fragilis strain DCMOUH0042B chromosome, complete genome 2 crisprs cas2,cas1,cas9,PrimPol,RT,DEDDh,PD-DExK,csa3,cas6,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,WYL 0 6 2 1
NZ_CP036552 Bacteroides fragilis strain DCMOUH0042B plasmid pBFO42_2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP036551 Bacteroides fragilis strain DCMOUH0042B plasmid pBFO42_1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP036550
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036550_1 357366-357719 orTypeII NA
4 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP036550_2 3687746-3689184 TypeIII NA
20 spacers
cas2,cas1,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 BK010646 TPA_exp: Bacteroides phage p00, complete sequence 36771-36800 0 1.0
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 JQ680371 Unidentified phage clone 2207_scaffold314 genomic sequence 2824-2853 0 1.0
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 JQ680363 Unidentified phage clone 2020_scaffold1264 genomic sequence 6033-6062 0 1.0
NZ_CP036550_1 1.1|357413|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357413-357442 30 MN694251 Marine virus AFVG_250M445, complete genome 2134-2163 6 0.8
NZ_CP036550_1 1.3|357567|29|NZ_CP036550|PILER-CR,CRISPRCasFinder 357567-357595 29 NZ_CP017565 Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence 248647-248675 6 0.793
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 73223-73252 6 0.8
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 NZ_CP040762 Paracoccus sp. 2251 plasmid unnamed2, complete sequence 177185-177214 7 0.767
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 402022-402051 8 0.733
NZ_CP036550_2 2.4|3687991|36|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT 3687991-3688026 36 MF417875 Uncultured Caudovirales phage clone 10S_11, partial genome 42764-42799 8 0.778
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 BK010646 TPA_exp: Bacteroides phage p00, complete sequence 13936-13965 9 0.7
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 NZ_CP051517 Paraburkholderia aromaticivorans strain AR20-38 plasmid unnamed1 98227-98256 9 0.7
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 NZ_KJ909292 Aeromonas salmonicida subsp. salmonicida strain 2009-144K3 plasmid pAB5S9b, complete sequence 19739-19768 9 0.7
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 NZ_BK008853 Aeromonas bestiarum strain 5S9 plasmid pAb5S9, complete sequence 18915-18944 9 0.7
NZ_CP036550_1 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder 357643-357672 30 NC_009476 Aeromonas bestiarum 5S9 plasmid pAb5S9, complete sequence 20932-20961 9 0.7
NZ_CP036550_2 2.7|3688204|35|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT 3688204-3688238 35 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 296308-296342 9 0.743
NZ_CP036550_2 2.6|3688132|37|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT 3688132-3688168 37 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 9904-9940 10 0.73
NZ_CP036550_2 2.6|3688132|37|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT 3688132-3688168 37 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 312233-312269 10 0.73
NZ_CP036550_2 2.6|3688132|37|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT 3688132-3688168 37 NC_019749 Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.02, complete sequence 82001-82037 12 0.676

1. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to BK010646 (TPA_exp: Bacteroides phage p00, complete sequence) position: , mismatch: 0, identity: 1.0

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
ttgttgctgtccgtgtcgtccagcgggtag	Protospacer
******************************

2. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to JQ680371 (Unidentified phage clone 2207_scaffold314 genomic sequence) position: , mismatch: 0, identity: 1.0

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
ttgttgctgtccgtgtcgtccagcgggtag	Protospacer
******************************

3. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to JQ680363 (Unidentified phage clone 2020_scaffold1264 genomic sequence) position: , mismatch: 0, identity: 1.0

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
ttgttgctgtccgtgtcgtccagcgggtag	Protospacer
******************************

4. spacer 1.1|357413|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to MN694251 (Marine virus AFVG_250M445, complete genome) position: , mismatch: 6, identity: 0.8

gattcgaagatatgcaaatgtagcaagtat	CRISPR spacer
aattgacagataagcaaatggagcaagtat	Protospacer
.*** . ***** ******* *********

5. spacer 1.3|357567|29|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NZ_CP017565 (Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence) position: , mismatch: 6, identity: 0.793

gatcgtgtttgcggagcattaccaagagg	CRISPR spacer
aagcgtgtttgcggagcactacaaagtcg	Protospacer
.* ***************.*** ***  *

6. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 6, identity: 0.8

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
gtggcgctgtccgtgtcgtcgagctggtgg	Protospacer
 ** .*************** *** ***.*

7. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
ccggcgcggtccgtgtcgtccagcggctgg	Protospacer
..* .** ****************** *.*

8. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 8, identity: 0.733

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
gacttgctgtcggtgacgtccagcggcacg	Protospacer
   ******** *** **********   *

9. spacer 2.4|3687991|36|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT matches to MF417875 (Uncultured Caudovirales phage clone 10S_11, partial genome) position: , mismatch: 8, identity: 0.778

gctttttcattttttaataattttaagtgttataaa--	CRISPR spacer
cctttttcatattttaataaatttaa--gctatgattt	Protospacer
 ********* ********* *****  *.***.*   

10. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to BK010646 (TPA_exp: Bacteroides phage p00, complete sequence) position: , mismatch: 9, identity: 0.7

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
ccggtgctgtccgcgtcgtccagcgccctc	Protospacer
..* *********.***********  .  

11. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NZ_CP051517 (Paraburkholderia aromaticivorans strain AR20-38 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
ttgttgttctccgtgtcgtccaggaaagcc	Protospacer
******.* ************** ...   

12. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NZ_KJ909292 (Aeromonas salmonicida subsp. salmonicida strain 2009-144K3 plasmid pAB5S9b, complete sequence) position: , mismatch: 9, identity: 0.7

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
gcttttctgtccgtgtcgtccagctcatgc	Protospacer
 . ** ******************  .*. 

13. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NZ_BK008853 (Aeromonas bestiarum strain 5S9 plasmid pAb5S9, complete sequence) position: , mismatch: 9, identity: 0.7

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
gcttttctgtccgtgtcgtccagctcatgc	Protospacer
 . ** ******************  .*. 

14. spacer 1.4|357643|30|NZ_CP036550|PILER-CR,CRISPRCasFinder matches to NC_009476 (Aeromonas bestiarum 5S9 plasmid pAb5S9, complete sequence) position: , mismatch: 9, identity: 0.7

ttgttgctgtccgtgtcgtccagcgggtag	CRISPR spacer
gcttttctgtccgtgtcgtccagctcatgc	Protospacer
 . ** ******************  .*. 

15. spacer 2.7|3688204|35|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 9, identity: 0.743

aaaattaataaataaacttccatagcttttatttt	CRISPR spacer
acatcatctaaaaaaacttccatagcttttctttg	Protospacer
* * .   **** ***************** *** 

16. spacer 2.6|3688132|37|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 10, identity: 0.73

aactcttaaattatttaattcaatttctttttccacc	CRISPR spacer
gattatataattatttaattctttttctttttcctta	Protospacer
.*.* *  *************  *********** . 

17. spacer 2.6|3688132|37|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 10, identity: 0.73

aactcttaaattatttaattcaatttctttttccacc	CRISPR spacer
gattatataattatttaattctttttctttttcctta	Protospacer
.*.* *  *************  *********** . 

18. spacer 2.6|3688132|37|NZ_CP036550|PILER-CR,CRISPRCasFinder,CRT matches to NC_019749 (Stanieria cyanosphaera PCC 7437 plasmid pSTA7437.02, complete sequence) position: , mismatch: 12, identity: 0.676

aactcttaaattatttaattcaatttctttttccacc	CRISPR spacer
ttcttttaaattatttaattcactttctgtaagagta	Protospacer
  **.***************** ***** *    .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 591582 : 663329 55 Catovirus(14.29%) tRNA,transposase,protease,integrase,holin attL 581988:582004|attR 665949:665965
DBSCAN-SWA_2 3112572 : 3186120 52 unidentified_phage(28.57%) protease,integrase attL 3160928:3160941|attR 3186276:3186289
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP036550.1|WP_002560961.1|2739497_2739914_+|hypothetical-protein 2739497_2739914_+ 138 aa aa 40 NA NA No NA