Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007663 Brucella abortus strain 63 75 chromosome 1, complete sequence 1 crisprs csa3,WYL,DEDDh 0 1 2 0
NZ_CP007662 Brucella abortus strain 63 75 chromosome 2, complete sequence 1 crisprs csa3,cas3,DEDDh 0 0 0 0

Results visualization

1. NZ_CP007663
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007663_1 1560961-1561049 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007663_1 1.1|1560987|37|NZ_CP007663|CRISPRCasFinder 1560987-1561023 37 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 75259-75295 8 0.784

1. spacer 1.1|1560987|37|NZ_CP007663|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.784

gtcgatccgaccgctgttccggccaatggcagtcttg	CRISPR spacer
atcgatccgaccgctgttcctgccgatggcgaacccg	Protospacer
.******************* ***.*****.. *..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 313832 : 416605 96 Hokovirus(10.0%) transposase,holin,integrase,portal,tail,protease,head,capsid attL 409179:409193|attR 419214:419228
DBSCAN-SWA_2 640518 : 652446 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP007662
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007662_1 211582-211682 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage