Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007761 Brucella melitensis bv. 3 str. Ether chromosome 2, complete sequence 0 crisprs DEDDh,csa3,cas3 0 0 0 0
NZ_CP007760 Brucella melitensis bv. 3 str. Ether chromosome 1, complete sequence 1 crisprs csa3,WYL 0 1 3 0

Results visualization

1. NZ_CP007760
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007760_1 759544-759626 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007760_1 1.1|759572|27|NZ_CP007760|CRISPRCasFinder 759572-759598 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|759572|27|NZ_CP007760|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 453127 : 461466 10 Brucella_phage(33.33%) NA NA
DBSCAN-SWA_2 532161 : 544089 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 768745 : 815142 40 Mesorhizobium_phage(14.29%) tail,integrase,head,protease attL 759551:759565|attR 772988:773002
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage