Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007623 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP007622 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP007624 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 0 crisprs RT,cas14j 0 0 1 0
NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 0 crisprs cas14j,RT 0 0 2 0
NZ_CP007621 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP007626 Bacillus pseudomycoides strain 219298 chromosome, complete genome 9 crisprs DEDDh,cas3,csa3,cas14j,WYL,DinG,Cas14b_CAS-V-F 1 2 6 0

Results visualization

1. NZ_CP007624
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33489 : 82470 41 Bacillus_phage(42.86%) transposase,integrase attL 26511:26558|attR 72683:72730
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP007626
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_1 411561-411709 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_2 1327329-1327429 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_3 1729143-1729225 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_4 2152750-2152862 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_5 2631706-2631811 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_6 3620611-3620721 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_7 3675371-3675454 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_9 5130001-5130107 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007626_8 5129791-5129901 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP007626_4 4.1|2152786|41|NZ_CP007626|CRISPRCasFinder 2152786-2152826 41 NZ_CP007626.1 2144807-2144847 2 0.951

1. spacer 4.1|2152786|41|NZ_CP007626|CRISPRCasFinder matches to position: 2144807-2144847, mismatch: 2, identity: 0.951

ttctccctttgttttaaattcggcatggggcgaaaaaagga	CRISPR spacer
ttctccctttgttttaaactcggcatggggccaaaaaagga	Protospacer
******************.************ *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007626_1 1.1|411590|49|NZ_CP007626|PILER-CR 411590-411638 49 NZ_CP040783 Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence 424101-424149 4 0.918
NZ_CP007626_1 1.1|411590|49|NZ_CP007626|PILER-CR 411590-411638 49 NZ_CP014283 Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence 154619-154667 5 0.898
NZ_CP007626_1 1.1|411590|49|NZ_CP007626|PILER-CR 411590-411638 49 NZ_CP011156 Bacillus cereus strain HN001 plasmid pRML01, complete sequence 415597-415645 5 0.898
NZ_CP007626_1 1.2|411668|31|NZ_CP007626|PILER-CR 411668-411698 31 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 390922-390952 10 0.677

1. spacer 1.1|411590|49|NZ_CP007626|PILER-CR matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.918

cgatat-aaatatataagagccttgctacatttttttgtagtaaggctct	CRISPR spacer
-aatataaaaaatataagagccttgctacattttattgtagtaaggctct	Protospacer
 .**** *** *********************** ***************

2. spacer 1.1|411590|49|NZ_CP007626|PILER-CR matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 5, identity: 0.898

cgata-taaatatataagagccttgctacatttttttgtagtaaggctct	CRISPR spacer
-attattaaaaatataagagccttgctacattttattgtagtaaggctct	Protospacer
 . ** **** *********************** ***************

3. spacer 1.1|411590|49|NZ_CP007626|PILER-CR matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 5, identity: 0.898

cgatat-aaatatataagagccttgctacatttttttgtagtaaggctct	CRISPR spacer
-attataaaaaatataagagccttgctacattttattgtagtaaggctct	Protospacer
 . *** *** *********************** ***************

4. spacer 1.2|411668|31|NZ_CP007626|PILER-CR matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 10, identity: 0.677

ctatccatttaaatgtattggtactcaaaaa	CRISPR spacer
tagaaagtttaaaagtattgatactcaaaag	Protospacer
. .   .****** ******.*********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 735538 : 742658 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 756820 : 846192 88 Bacillus_phage(60.53%) integrase,coat,tRNA,plate,bacteriocin,terminase,transposase,tail,protease attL 829855:829871|attR 831773:831789
DBSCAN-SWA_3 2417119 : 2467576 50 Bacillus_virus(14.29%) integrase,tRNA,transposase,holin,protease attL 2440325:2440343|attR 2470183:2470201
DBSCAN-SWA_4 2714744 : 2722745 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_5 3375888 : 3385584 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_6 3824813 : 3832225 7 Bacillus_phage(66.67%) integrase attL 3823079:3823093|attR 3836076:3836090
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP007625
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5469 : 131535 115 Bacillus_phage(52.78%) transposase,holin,integrase,protease attL 36242:36260|attR 80900:80915
DBSCAN-SWA_2 166305 : 219229 34 Streptococcus_phage(25.0%) transposase,integrase attL 151123:151149|attR 226891:226917
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage