Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP008926 Streptococcus pyogenes strain ATCC 19615 chromosome, complete genome 3 crisprs DEDDh,csa3,cas3,DinG,csm6,cas9,cas1,cas2,csn2 0 1 8 0

Results visualization

1. NZ_CP008926
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008926_1 16130-16219 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008926_2 116157-116258 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP008926_3 1782348-1782442 TypeII II-A
1 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448944 Streptococcus phage Javan452, complete genome 12345-12381 7 0.811
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448672 Streptococcus phage Javan117, complete genome 7926-7962 7 0.811
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448849 Streptococcus phage Javan128, complete genome 7830-7866 7 0.811
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448850 Streptococcus phage Javan132, complete genome 12655-12691 7 0.811
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448675 Streptococcus phage Javan129, complete genome 12135-12171 7 0.811
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448673 Streptococcus phage Javan119, complete genome 11431-11467 7 0.811
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448845 Streptococcus phage Javan118, complete genome 9809-9845 8 0.784
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK449010 Streptococcus phage Javan90, complete genome 10515-10551 9 0.757
NZ_CP008926_3 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder 1782377-1782413 37 MK448833 Streptococcus phage Javan87, complete genome 10515-10551 9 0.757

1. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

2. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

3. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

4. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448850 (Streptococcus phage Javan132, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gttttatcgctagacatctcaacatctggaacgggat	Protospacer
 .   *.*.****************************

5. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448675 (Streptococcus phage Javan129, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcactagacatctcaacatctggaacaggtt	Protospacer
 .*  *.*************************.** *

6. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 7, identity: 0.811

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatttcaacatctggaacgggat	Protospacer
 .*  *.*.********.*******************

7. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 8, identity: 0.784

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatttcaacatctggaacgggtt	Protospacer
 .*  *.*.********.***************** *

8. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 9, identity: 0.757

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatctcaacatctggtacaggtt	Protospacer
 .*  *.*.******************** **.** *

9. spacer 3.1|1782377|37|NZ_CP008926|CRISPRCasFinder matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 9, identity: 0.757

ccaaaaccactagacatctcaacatctggaacgggat	CRISPR spacer
gtattatcgctagacatctcaacatctggtacaggtt	Protospacer
 .*  *.*.******************** **.** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 158998 : 190226 29 Bacillus_phage(20.0%) transposase,integrase,protease attL 157171:157186|attR 176020:176035
DBSCAN-SWA_2 204237 : 313227 114 Streptococcus_phage(55.71%) portal,integrase,terminase,protease,transposase,holin,capsid,tail,tRNA,head attL 246649:246668|attR 290910:290929
DBSCAN-SWA_3 413265 : 476220 74 Streptococcus_phage(79.25%) portal,integrase,terminase,protease,holin,capsid,tRNA,tail attL 430119:430134|attR 476249:476264
DBSCAN-SWA_4 645751 : 694137 72 Streptococcus_phage(30.51%) portal,integrase,terminase,holin,tail,head attL 662572:662586|attR 699556:699570
DBSCAN-SWA_5 920938 : 940406 23 Streptococcus_phage(64.71%) holin,integrase attL 924137:924157|attR 937707:937727
DBSCAN-SWA_6 1039029 : 1051332 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_7 1329081 : 1426554 100 Streptococcus_phage(20.69%) transposase,bacteriocin,tRNA,protease NA
DBSCAN-SWA_8 1624644 : 1699882 68 Streptococcus_phage(20.0%) transposase,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage