Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009256 Acinetobacter baumannii strain AB31 chromosome, complete genome 3 crisprs csa3,WYL,DEDDh,RT,cas3 1 0 5 0

Results visualization

1. NZ_CP009256
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009256_1 1879661-1879824 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009256_2 2502260-2502404 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009256_3 2730383-2730471 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009256_2 2.1|2502306|53|NZ_CP009256|CRISPRCasFinder 2502306-2502358 53 NZ_CP009256.1 2502208-2502260 2 0.962

1. spacer 2.1|2502306|53|NZ_CP009256|CRISPRCasFinder matches to position: 2502208-2502260, mismatch: 2, identity: 0.962

ctgtaaaaagttcaatacaaattaaccataactatgtttatcttgcgcttcgc	CRISPR spacer
ctgtaaaaagttcaatacaaattaatcataattatgtttatcttgcgcttcgc	Protospacer
*************************.*****.*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2593833 : 2629646 44 Acinetobacter_phage(69.7%) terminase,capsid,tail,transposase NA
DBSCAN-SWA_2 2633451 : 2645025 24 Acinetobacter_phage(90.48%) integrase attL 2626848:2626862|attR 2650991:2651005
DBSCAN-SWA_3 2940642 : 2964402 43 Acinetobacter_phage(65.52%) terminase,integrase attL 2951704:2951717|attR 2966634:2966647
DBSCAN-SWA_4 3060107 : 3079105 15 Acinetobacter_phage(57.14%) tail,integrase attL 3055605:3055619|attR 3081079:3081093
DBSCAN-SWA_5 3082917 : 3122763 50 Acinetobacter_phage(79.55%) terminase,capsid,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage