Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009224 Weissella ceti strain WS105 chromosome, complete genome 2 crisprs cas3,DEDDh,DinG,csa3 0 1 3 0

Results visualization

1. NZ_CP009224
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009224_1 83410-83501 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009224_2 1348198-1348372 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009224_1 1.1|83442|28|NZ_CP009224|CRISPRCasFinder 83442-83469 28 KY499642 Vibrio phage pVa-21, complete genome 167841-167868 6 0.786

1. spacer 1.1|83442|28|NZ_CP009224|CRISPRCasFinder matches to KY499642 (Vibrio phage pVa-21, complete genome) position: , mismatch: 6, identity: 0.786

tggcggaaaccgtaatggtggacgcggt	CRISPR spacer
atgcggaaaccgcaatggtggaagccat	Protospacer
  **********.********* ** .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 561247 : 568593 6 Caulobacter_phage(16.67%) NA NA
DBSCAN-SWA_2 688472 : 707466 22 Enterococcus_phage(29.41%) tail,capsid,portal,head NA
DBSCAN-SWA_3 711088 : 722620 21 Lactobacillus_phage(44.44%) integrase attL 719700:719714|attR 730928:730942
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage