Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006693 Salmonella enterica subsp. arizonae serovar 62:z36:- str. RKS2983 chromosome, complete genome 1 crisprs cas3,DEDDh,DinG,PD-DExK 1 1 4 0

Results visualization

1. NZ_CP006693
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006693_1 967463-968031 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP006693_1 1.9|967972|31|NZ_CP006693|CRT 967972-968002 31 NZ_CP006693.1 1094790-1094820 1 0.968

1. spacer 1.9|967972|31|NZ_CP006693|CRT matches to position: 1094790-1094820, mismatch: 1, identity: 0.968

gcagctggttaccagcgaaaatcagctcctg	CRISPR spacer
gcagctggttaccagcgacaatcagctcctg	Protospacer
****************** ************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006693_1 1.1|967492|31|NZ_CP006693|CRT 967492-967522 31 MT773557 Myoviridae sp. isolate BML_S_1 genomic sequence 14817-14847 6 0.806

1. spacer 1.1|967492|31|NZ_CP006693|CRT matches to MT773557 (Myoviridae sp. isolate BML_S_1 genomic sequence) position: , mismatch: 6, identity: 0.806

gcagctggttatcaaacaccaccagctcctc	CRISPR spacer
gttggtggttatcaaacaaaaccagctcctg	Protospacer
*. * *************  ********** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 800406 : 812229 10 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_2 832401 : 876394 66 Salmonella_phage(68.85%) lysis,integrase,tail,head,capsid,holin attL 829906:829922|attR 864020:864036
DBSCAN-SWA_3 2572998 : 2636464 56 Enterobacteria_phage(64.71%) integrase,plate,transposase attL 2578221:2578236|attR 2588845:2588860
DBSCAN-SWA_4 2669964 : 2742157 59 Escherichia_phage(25.0%) plate,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage