1. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 5.19|927501|27|NZ_CP009426|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
5. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
6. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
7. spacer 7.2|1570625|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
8. spacer 7.2|1570625|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
9. spacer 7.2|1570625|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 7.2|1570625|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 7.2|1570625|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 7.3|1570679|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
13. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
14. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
15. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
16. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
17. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
18. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
19. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
23. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
24. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
25. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
26. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
27. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
28. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
29. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
30. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
31. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
32. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
33. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
34. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
35. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
36. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
37. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
38. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 2, identity: 0.92
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaaaggcggcaacggcg Protospacer
******************* ****
40. spacer 4.3|839301|25|NZ_CP009426|CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 3, identity: 0.88
aaacgccttcggcgctggcgaggtc CRISPR spacer
caacgccttcgccgctggcgagatc Protospacer
********** **********.**
41. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
42. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
43. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
44. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
45. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
46. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
47. spacer 5.18|927459|24|NZ_CP009426|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
48. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
49. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
50. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
51. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
52. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
53. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
54. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
55. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
56. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
57. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 3, identity: 0.889
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgg Protospacer
**************** ********
58. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 3, identity: 0.889
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcggcaacggcta Protospacer
******************.****** .
59. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MN549360 (Rhizobium phage RL38J1, complete genome) position: , mismatch: 3, identity: 0.889
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgctgg-cggcaaaggcggtaacggcgg Protospacer
****. ****** **************
60. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
61. spacer 7.4|1570733|22|NZ_CP009426|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
62. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
63. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
64. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
65. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
66. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
67. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
68. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
69. spacer 8.5|2067952|24|NZ_CP009426|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
70. spacer 8.5|2067952|24|NZ_CP009426|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
71. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
ctcggcggcaaaggcggcattggcg Protospacer
.****************** ****
72. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
cccggcggcaaaggcgcaatgggcg Protospacer
*************** *******
73. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaatggcggcattggcc Protospacer
*********** ******** ***
74. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
atcggcggcaagggcggcatggccg Protospacer
*.*********.********** **
75. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
aacggcggcaacggcggcaagggcg Protospacer
* ********* ******* *****
76. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
aacggcggcaacggcggcaagggcg Protospacer
* ********* ******* *****
77. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
aacggcggcaacggcggcaagggcg Protospacer
* ********* ******* *****
78. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
aacggcggcaacggcggcaagggcg Protospacer
* ********* ******* *****
79. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
aacggcggcaacggcggcaagggcg Protospacer
* ********* ******* *****
80. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
aacggcggcaacggcggcaggggcg Protospacer
* ********* ******* *****
81. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 3, identity: 0.88
accggcggcaaaggcggcatgggcg CRISPR spacer
aacggcggcaacggcggcaggggcg Protospacer
* ********* ******* *****
82. spacer 1.1|366155|27|NZ_CP009426|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
83. spacer 1.1|366155|27|NZ_CP009426|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
84. spacer 1.7|366551|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
85. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
86. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
87. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
88. spacer 4.1|839169|34|NZ_CP009426|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
caacggcgggcccggcgggtggttgatcggcaac CRISPR spacer
caacggcgcacccggcgggtggttgatcggtgac Protospacer
******** .********************..**
89. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
cctcgccttcggcgctggcgaggta Protospacer
*********************
90. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
ccacgccttcggcggtgccgaggtc Protospacer
************ ** *******
91. spacer 4.3|839301|25|NZ_CP009426|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
taaagccttcggcgctggcgacgta Protospacer
** ***************** **
92. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NZ_CP021410 (Celeribacter manganoxidans strain DY25 plasmid pDY25-F, complete sequence) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
tgacgcctacggcgcgggcgaggtc Protospacer
.****** ****** *********
93. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
caacgcctacggcgctcgcgaggtg Protospacer
******* ******* *******
94. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
cacagccctcggcgctggcgaggtc Protospacer
* ***.*****************
95. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
96. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
97. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
98. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
99. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
100. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
101. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
102. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
103. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
104. spacer 4.3|839301|25|NZ_CP009426|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
105. spacer 4.3|839301|25|NZ_CP009426|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 4, identity: 0.84
aaacgccttcggcgctggcgaggtc CRISPR spacer
aaaccccttcggccctggcgaggcg Protospacer
**** ******** *********.
106. spacer 5.12|927174|27|NZ_CP009426|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
107. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
108. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
109. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
110. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
111. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
112. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
113. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
114. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
115. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
116. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
117. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
118. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
119. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
120. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
121. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
122. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
123. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
124. spacer 5.18|927459|24|NZ_CP009426|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
125. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgg Protospacer
* .**********************
126. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MG198783 (Gordonia phage Mahdia, complete genome) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccagaccggcaacggcggtaacggcgt Protospacer
* **.********************
127. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 4, identity: 0.852
--gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggccgg--ggcaacggcggtaacggcgg Protospacer
**.*. ********************
128. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggtgatcgtcaacggcggcaacggcga Protospacer
* ****** *********.*******.
129. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgctcggccacggcggtaacggctg Protospacer
*** ***** ************** *
130. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggtgacgacag Protospacer
******************.***.*.*
131. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggtgacgacag Protospacer
******************.***.*.*
132. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcgggaacaaccg Protospacer
****************** ***..* *
133. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
--gctgatcggcaacggcggtaacggcgg CRISPR spacer
tagcgg--cggcaacggcggtagcggcgg Protospacer
** * **************.******
134. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.852
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg Protospacer
**.*. ************.********
135. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.852
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg Protospacer
**.*. ************.********
136. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
137. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
138. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
139. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
140. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
141. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
142. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
143. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
144. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
145. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
146. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
147. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
148. spacer 8.5|2067952|24|NZ_CP009426|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
149. spacer 8.5|2067952|24|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
150. spacer 8.5|2067952|24|NZ_CP009426|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
151. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaaaggcggcatccacc Protospacer
******************** .*
152. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
153. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
154. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
155. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
156. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
157. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
158. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
159. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
160. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
161. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
162. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
163. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
164. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
165. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
166. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
gacggcggcgaaggcggcacgggcg Protospacer
. *******.*********.*****
167. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
168. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
169. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
170. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
171. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
172. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
cccggcggcgaaggcggcctgggcc Protospacer
********.******** *****
173. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
174. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
atcgtcggcaaaggcggcatggggc Protospacer
*.** ******************
175. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
176. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
177. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
178. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
179. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
180. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
181. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
182. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ctcggccgcaaaggcggcattggcg Protospacer
.**** ************* ****
183. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggccaaggcggcatcggcg Protospacer
. ******* ********** ****
184. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ctcggccgcaaaggcggcattggcg Protospacer
.**** ************* ****
185. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcaaaggtggcatcggcg Protospacer
. ************.***** ****
186. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
187. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
188. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
cccggcggcgaaggcggcctgggcc Protospacer
********.******** *****
189. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
190. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
191. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
192. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
193. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
194. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
195. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
196. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
197. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
198. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
gccggcggcaaaggcggcatctgtg Protospacer
.******************* *.*
199. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
200. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
201. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
202. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
203. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
204. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
atcgtcggcaaaggcggcatggggc Protospacer
*.** ******************
205. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
206. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
207. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
208. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
209. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
210. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
211. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcgacggcggcatgggcg Protospacer
. *******.* *************
212. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
cccggcggcgaaggcggcctgggcc Protospacer
********.******** *****
213. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
cccggcggcgaaggcggcctgggcc Protospacer
********.******** *****
214. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
215. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
216. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
217. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcaaaagcggcctgggcg Protospacer
. **********.***** ******
218. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
219. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
220. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
221. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
gtcggcggcaatggcggcgtgggcg Protospacer
..********* ******.******
222. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaacggcggcatcgggc Protospacer
*********** ******** **
223. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
224. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
acaggcggcaagggcggcatgggtc Protospacer
** ********.***********.
225. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
226. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
227. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
228. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
229. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
230. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
231. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
232. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
233. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
234. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
235. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
236. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
237. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
238. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
239. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
240. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
241. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
242. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
243. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
244. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
245. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
246. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
247. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
248. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
249. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
250. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
251. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
252. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
253. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
254. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
255. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
tccggcggcaccggcggcatgggca Protospacer
********* ************.
256. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
257. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
258. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
259. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
260. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
261. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
262. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
263. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
264. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
265. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
266. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
267. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
268. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
269. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_042098 (Erwinia phage vB_EamM_Desertfox, complete genome) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
tccggcggcaaaggcgtcatggatg Protospacer
*************** *****..*
270. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MG655267 (Erwinia phage vB_EamM_Bosolaphorus, complete genome) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
tccggcggcaaaggcgtcatggatg Protospacer
*************** *****..*
271. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MG655269 (Erwinia phage vB_EamM_MadMel, complete genome) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
tccggcggcaaaggcgtcatggatg Protospacer
*************** *****..*
272. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to KF806589 (Erwinia phage Ea35-70, complete genome) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
tccggcggcaaaggcgtcatggatg Protospacer
*************** *****..*
273. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to KU886223 (Erwinia phage vB_EamM_Simmy50, complete genome) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
tccggcggcaaaggcgtcatggatg Protospacer
*************** *****..*
274. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
275. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
276. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
277. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
278. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
279. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
280. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
281. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
282. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
283. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
284. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
285. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
286. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
287. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
288. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
289. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
290. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
291. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
292. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
293. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaacggcggcatcgggc Protospacer
*********** ******** **
294. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
295. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
296. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
297. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
298. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
299. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
300. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
301. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
302. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
303. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
304. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
305. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
306. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
307. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
308. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
309. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
310. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
311. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
312. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
313. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
314. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
315. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
316. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
317. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
318. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
319. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
320. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaacggcggcatcgggc Protospacer
*********** ******** **
321. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcagaggcggcaagggcg Protospacer
. ********.******** *****
322. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
323. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
324. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
325. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
326. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
gccggcggcaatgtcggcatgggca Protospacer
.********** * **********.
327. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
328. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
329. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ctcggccgcaaaggcggcattggcg Protospacer
.**** ************* ****
330. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
331. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
332. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
333. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
334. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
335. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
336. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
337. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
338. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcaaaggcggcaagagcg Protospacer
. ***************** *.***
339. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
340. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
341. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
342. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
343. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcaaacgcggcctgggcg Protospacer
. ********** ***** ******
344. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
345. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
346. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
347. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
348. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
gccggcggcaagggcggcacgggcc Protospacer
.**********.*******.****
349. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
350. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
351. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
352. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
353. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
354. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
355. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
356. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
357. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
358. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
359. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
360. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
361. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
362. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcaaaggcggcgagggcg Protospacer
. ****************. *****
363. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
364. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
365. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
366. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
367. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
368. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
369. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
370. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
371. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
372. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
373. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
374. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaacggcggcatcgggc Protospacer
*********** ******** **
375. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
376. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ctcggccgcaaaggcggcattggcg Protospacer
.**** ************* ****
377. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
378. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
379. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
380. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
381. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
382. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
383. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
384. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
385. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
386. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
387. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
388. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
389. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
390. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
391. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
392. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
393. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
394. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
395. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
396. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
397. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
398. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
399. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
400. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
401. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
402. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
403. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
404. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
405. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcatgggcggcatgggcg Protospacer
. ******** .*************
406. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 4, identity: 0.84
accggcggcaaaggcggcatgggcg CRISPR spacer
ggcggcggcaaaggcggcaagggag Protospacer
. ***************** *** *
407. spacer 1.1|366155|27|NZ_CP009426|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
408. spacer 1.1|366155|27|NZ_CP009426|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
409. spacer 1.7|366551|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
410. spacer 1.7|366551|27|NZ_CP009426|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
411. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
412. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
413. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
414. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
415. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
416. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
417. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
418. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
419. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
420. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
421. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
422. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
423. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
424. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
425. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
426. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
427. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
428. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
429. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
430. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
431. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
432. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
433. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
434. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
435. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
436. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
437. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
438. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
439. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
440. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
441. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 5, identity: 0.8
aaacgccttcggcgctggcgaggtc CRISPR spacer
cgtcgccttcggcgatggcgaggtt Protospacer
. *********** *********.
442. spacer 4.3|839301|25|NZ_CP009426|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.8
aaacgccttcggcgctggcgaggtc CRISPR spacer
caacgccttcggcgctggcggccac Protospacer
*******************. *
443. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 5, identity: 0.8
aaacgccttcggcgctggcgaggtc CRISPR spacer
ggttgcgttcggcgctggcgaggtc Protospacer
.. .** ******************
444. spacer 4.3|839301|25|NZ_CP009426|CRT matches to NZ_CP048425 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8
aaacgccttcggcgctggcgaggtc CRISPR spacer
tctcgccttcggcgctggcgagaac Protospacer
*******************. *
445. spacer 5.5|926880|27|NZ_CP009426|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
446. spacer 5.5|926880|27|NZ_CP009426|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
447. spacer 5.5|926880|27|NZ_CP009426|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
448. spacer 5.5|926880|27|NZ_CP009426|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
449. spacer 5.5|926880|27|NZ_CP009426|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
450. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 5, identity: 0.833
cggattcggcggattccgcggcggggaggg CRISPR spacer
cggattcgcccgattccgcggcggcccggg Protospacer
******** * ************* ***
451. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.833
cggattcggcggattccgcggcggggaggg CRISPR spacer
cggattcgcccgattccgcggcggcacggg Protospacer
******** * ************* . ***
452. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
453. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
454. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
455. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
456. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
457. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
458. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
459. spacer 5.12|927174|27|NZ_CP009426|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
460. spacer 5.12|927174|27|NZ_CP009426|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
461. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
462. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
463. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
464. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
465. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
466. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
467. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
468. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
469. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
470. spacer 5.17|927411|30|NZ_CP009426|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
471. spacer 5.18|927459|24|NZ_CP009426|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
472. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggtaacgccgg Protospacer
.*.*. ***************** ***
473. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gttcttcggcaacggcggcaacggcgc Protospacer
*.* *************.*******
474. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
475. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcgacaacggttt Protospacer
*****************..*****.
476. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
477. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
478. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
479. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
480. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
481. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggctgtgacgccac Protospacer
**************** **.*** *.
482. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
483. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
484. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 5, identity: 0.815
gctgat--cggcaacggcggtaacggcgg CRISPR spacer
--cgacggcggcaatggcggtaacggcgg Protospacer
.**. ******.**************
485. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgaacggcaacggcggcaacgacac Protospacer
***** ************.****.*.
486. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
487. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
488. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
489. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
490. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
491. spacer 5.19|927501|27|NZ_CP009426|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
492. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
493. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
494. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
495. spacer 5.19|927501|27|NZ_CP009426|CRT matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcatcggcggttacgacaa Protospacer
*********** ******* ***.*..
496. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
497. spacer 5.19|927501|27|NZ_CP009426|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
498. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
499. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
500. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
501. spacer 5.19|927501|27|NZ_CP009426|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
502. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
503. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
504. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggtggcaacgactt Protospacer
***************.**.****.*
505. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
506. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
507. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
508. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggccacggcggcaacgacat Protospacer
********** *******.****.*.
509. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
510. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
511. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
512. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
513. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
514. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
515. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
516. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
517. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
518. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
519. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggctgtgacgccac Protospacer
**************** **.*** *.
520. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
521. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
522. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
523. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcatcggcggttacgacaa Protospacer
*********** ******* ***.*..
524. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
525. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
526. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
527. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
528. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
529. spacer 7.5|1570787|25|NZ_CP009426|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
530. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
531. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
532. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
533. spacer 7.13|1571420|34|NZ_CP009426|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
534. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 5, identity: 0.8
accggcggcaaaggcggcatgggcg CRISPR spacer
cttctcggcaaaggcggcatgggcg Protospacer
.. ********************
535. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.8
accggcggcaaaggcggcatgggcg CRISPR spacer
accggcggcaaaggcggcaacctct Protospacer
******************* *
536. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 5, identity: 0.8
accggcggcaaaggcggcatgggcg CRISPR spacer
gccggcggcaagggcggcatggcgt Protospacer
.**********.**********
537. spacer 14.4|3918277|25|NZ_CP009426|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 5, identity: 0.8
accggcggcaaaggcggcatgggcg CRISPR spacer
gccggcggcaagggcggcatggcgt Protospacer
.**********.**********
538. spacer 1.1|366155|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
539. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
540. spacer 1.7|366551|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
541. spacer 1.9|366701|27|NZ_CP009426|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
542. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
543. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
544. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
545. spacer 1.10|366761|27|NZ_CP009426|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
546. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
547. spacer 2.2|630829|30|NZ_CP009426|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
548. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
549. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
550. spacer 2.2|630829|30|NZ_CP009426|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
551. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
552. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
553. spacer 2.2|630829|30|NZ_CP009426|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
554. spacer 2.2|630829|30|NZ_CP009426|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
555. spacer 2.2|630829|30|NZ_CP009426|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
556. spacer 2.2|630829|30|NZ_CP009426|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
557. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
558. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
559. spacer 2.2|630829|30|NZ_CP009426|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
560. spacer 2.2|630829|30|NZ_CP009426|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
561. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
562. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.806
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
actcggcgggaacgccgcgctgttcggcgcg Protospacer
. .*************..************
563. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
ggtcggcgggaccgccatgctgttcctcgtg Protospacer
**.******** ************* **.
564. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.806
ggccgg--cgggaacgccatgctgttcggcgcc CRISPR spacer
--cctgtcctggatcgccatgctgttcgccgcc Protospacer
** * * *** ************** ****
565. spacer 5.5|926880|27|NZ_CP009426|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
566. spacer 5.5|926880|27|NZ_CP009426|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
567. spacer 5.5|926880|27|NZ_CP009426|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
568. spacer 5.5|926880|27|NZ_CP009426|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
569. spacer 5.5|926880|27|NZ_CP009426|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
570. spacer 5.5|926880|27|NZ_CP009426|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
571. spacer 5.5|926880|27|NZ_CP009426|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
572. spacer 5.5|926880|27|NZ_CP009426|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
573. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
574. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
575. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
576. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
577. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
578. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
579. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
580. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
581. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
582. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
583. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
584. spacer 5.8|927015|30|NZ_CP009426|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
585. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
586. spacer 5.8|927015|30|NZ_CP009426|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
587. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcggggtccg Protospacer
************ *********** *
588. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcggggtccg Protospacer
************ *********** *
589. spacer 5.12|927174|27|NZ_CP009426|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
590. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
591. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
592. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
593. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
594. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
595. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
596. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
597. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
598. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
599. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
600. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
601. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
602. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
603. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
604. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
605. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
606. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
607. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
608. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
609. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
610. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
611. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
612. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
613. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
614. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
615. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
616. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
617. spacer 5.17|927411|30|NZ_CP009426|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
618. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
619. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
620. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
621. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
622. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
623. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
624. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
625. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
626. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
627. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
628. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
629. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
630. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
631. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
632. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
633. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
634. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
635. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
636. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
637. spacer 5.17|927411|30|NZ_CP009426|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
638. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
aacgggcggcaacggcggcaacggcgg Protospacer
. .*. ************.********
639. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccccggcggcaacggcggcaacggcgg Protospacer
*. . ************.********
640. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
acgcggcggcgacggcggtaacggcgg Protospacer
.* . ****.****************
641. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgaaagcggcaacggcggtaacggcga Protospacer
.* ********************.
642. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccacgctggcaacggcggtaacggcgg Protospacer
* ...********************
643. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcgg Protospacer
* . . ************ ********
644. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacgccggcaacgatac Protospacer
************** ***.****...
645. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gagcggcggcaacggcggcaacggcgg Protospacer
* . ************.********
646. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggccggcggcagcggcggtaacggcgg Protospacer
* . . *****.***************
647. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggacgccggcaacggcggcaacggcgg Protospacer
* ..************.********
648. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccatcggcaacggcggtagcggtgg Protospacer
. ****************.***.**
649. spacer 5.19|927501|27|NZ_CP009426|CRT matches to KR997929 (Mycobacterium phage Barriga, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
650. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MH576971 (Mycobacterium phage Arlo, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
651. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_028815 (Mycobacterium phage Nhonho, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
652. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gagcggcggcaacggcggtaccggcgg Protospacer
* . ************** ******
653. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
actgagcggcaacggcggaaacggaat Protospacer
.**** ************ ***** .
654. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatcggcaacggcggttgcggcgg Protospacer
*************** .******
655. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacgccggcaacgatac Protospacer
************** ***.****...
656. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
actgagcggcaacggcggaaacggaat Protospacer
.**** ************ ***** .
657. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
658. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
659. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
660. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
661. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
662. spacer 7.13|1571420|34|NZ_CP009426|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
663. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
aacggcggggccggcggtagcggcggcgcaggcg Protospacer
*.************************ ** ..*
664. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 6, identity: 0.824
agcggcggggccggcggtagcggcggggccaact-- CRISPR spacer
ggcggcgcggccggcggcagcggc--ggccaacccg Protospacer
.****** *********.****** *******.
665. spacer 1.4|366350|27|NZ_CP009426|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
666. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
667. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
668. spacer 2.2|630829|30|NZ_CP009426|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
669. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
670. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
671. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
672. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
673. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
674. spacer 2.2|630829|30|NZ_CP009426|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
675. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
676. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
677. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
678. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
679. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
680. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
681. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
682. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
683. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
684. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
685. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
686. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
687. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
688. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
689. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
690. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
691. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
692. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 7, identity: 0.774
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
gtccggcgagaacgcgatgctgttcgcgatc Protospacer
* ******.****** ********** ..*
693. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 7, identity: 0.774
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
gtccggcgagaacgcgatgctgttcgcgatc Protospacer
* ******.****** ********** ..*
694. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcgggatccg Protospacer
************ **********. *
695. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcgggatccg Protospacer
************ **********. *
696. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
cccgctgggcggattccgcgtcggggaagg Protospacer
* ..* ************* ******.**
697. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
gggattcggtggattcagcggcggtggtgc Protospacer
********.****** ******* *. *
698. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
699. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
700. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
701. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
702. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
703. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
704. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
705. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
706. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
707. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
708. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
709. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
710. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
711. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
712. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
713. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
714. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
715. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
716. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
717. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
718. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
719. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
720. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
721. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
722. spacer 5.15|927315|30|NZ_CP009426|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
723. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
724. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
725. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
726. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
727. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
728. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
729. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
730. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
731. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
732. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
733. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
734. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
735. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
736. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
737. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
738. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
739. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
740. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
741. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
742. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
743. spacer 5.15|927315|30|NZ_CP009426|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
744. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
745. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
746. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
747. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
748. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
749. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
750. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
751. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
752. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
753. spacer 5.15|927315|30|NZ_CP009426|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
754. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
755. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
756. spacer 5.15|927315|30|NZ_CP009426|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
757. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
758. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
759. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
760. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
761. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
762. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
763. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
764. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
765. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
766. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
767. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
768. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
769. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
770. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
771. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
772. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
773. spacer 5.15|927315|30|NZ_CP009426|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
774. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
775. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
776. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
777. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
778. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
779. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
780. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
781. spacer 5.15|927315|30|NZ_CP009426|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
782. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
783. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
784. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
785. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
786. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
787. spacer 5.15|927315|30|NZ_CP009426|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
788. spacer 5.15|927315|30|NZ_CP009426|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
789. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
790. spacer 5.15|927315|30|NZ_CP009426|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
791. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
792. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
793. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
794. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
795. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
796. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
797. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
798. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
799. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
800. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
801. spacer 5.17|927411|30|NZ_CP009426|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
802. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
803. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
804. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
805. spacer 5.17|927411|30|NZ_CP009426|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
806. spacer 5.17|927411|30|NZ_CP009426|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
807. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
808. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
809. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
810. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
811. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
812. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
813. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgcaggcggcaacggcggtagcggcgg Protospacer
... **************.******
814. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
815. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
816. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
atctggaggcaacggcggtaacggcgg Protospacer
... . ********************
817. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
818. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
819. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
820. spacer 5.19|927501|27|NZ_CP009426|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
821. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctcgatcagcaacggcggtaacggttt Protospacer
..****.****************.
822. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
823. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
824. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
825. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cacccccggaaacggcggtaacggcgg Protospacer
. .*** *****************
826. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
827. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
828. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
829. spacer 5.19|927501|27|NZ_CP009426|CRT matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
830. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
831. spacer 5.19|927501|27|NZ_CP009426|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
832. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
833. spacer 5.19|927501|27|NZ_CP009426|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
834. spacer 7.1|1570565|28|NZ_CP009426|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
835. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
836. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
837. spacer 8.3|2067862|30|NZ_CP009426|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
838. spacer 8.3|2067862|30|NZ_CP009426|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
839. spacer 8.3|2067862|30|NZ_CP009426|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
840. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.794
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggggacggcggcagcggcggcgggctct Protospacer
********** ******.******** * **
841. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
842. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
843. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
844. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
845. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
846. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
847. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
848. spacer 4.1|839169|34|NZ_CP009426|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
caacggcgggcccggcgggtggttgatcggcaac CRISPR spacer
cctctgcggacccggcgagtggttgatcgagaag Protospacer
* * ****.*******.***********. **
849. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
tggggccgggaacgacacgctgttcggcgag Protospacer
* * ******** **.***********
850. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.742
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
cgacggcgggaccgccaagctgttcgaaacg Protospacer
* ******** ***** ********. .*
851. spacer 4.6|839445|34|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggaaacgccggcatgctgttcggcgcc---- CRISPR spacer
agccggcggcaacgccggcatgct----ggagtcgcgc Protospacer
.******** ************** ** *.*
852. spacer 4.7|839502|31|NZ_CP009426|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.742
attctcgaacggcggtgccaccggcggggca CRISPR spacer
accatcgaacggcggcgccaccggcaggcgc Protospacer
*.. ***********.*********.**
853. spacer 4.7|839502|31|NZ_CP009426|CRT matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 8, identity: 0.742
attctcgaacggcggtgccaccggcggggca CRISPR spacer
tcgccggaacggtggtgccaccggccgggta Protospacer
. *. ******.************ ***.*
854. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733
cggattcggcggattccgcggcggggaggg CRISPR spacer
agttcgcggcggaatccgcggcggggaacg Protospacer
* . ******* *************. *
855. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
cggattcggcggattccgcggcggggaggg CRISPR spacer
gcccttcggcggatgccgcggcggcgagct Protospacer
********** ********* ***
856. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
857. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
858. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
859. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
860. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
861. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
862. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
863. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
864. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
865. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
866. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
867. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
868. spacer 5.15|927315|30|NZ_CP009426|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
869. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
870. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
871. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
872. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
873. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
874. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
875. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
876. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
877. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
878. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
879. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
880. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
881. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
882. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
883. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
884. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
885. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
886. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
887. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
888. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
889. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
890. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
891. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
892. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
893. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
894. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
895. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
896. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
897. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
898. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
899. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
900. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
901. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
902. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
903. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
904. spacer 8.3|2067862|30|NZ_CP009426|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
905. spacer 8.3|2067862|30|NZ_CP009426|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
906. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
gccggcggggccggcgggaccggcggggccgggg Protospacer
. *************** * **********..
907. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
908. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
909. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
910. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
911. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
912. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
913. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
914. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
915. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
******** *.*************** * . *
916. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggggacggcggcagcggcgtgcagcgct Protospacer
********** ******.******* * .**
917. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
918. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
919. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
920. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
921. spacer 2.2|630829|30|NZ_CP009426|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
922. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
923. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
924. spacer 3.1|691543|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
925. spacer 4.1|839169|34|NZ_CP009426|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
caacggcgggcccggcgggtggttgatcggcaac CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg Protospacer
******* **************.**. **...
926. spacer 4.1|839169|34|NZ_CP009426|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735
caacggcgggcccggcgggtggttgatcggcaac CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg Protospacer
******* **************.**. **...
927. spacer 4.1|839169|34|NZ_CP009426|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
caacggcgggcccggcgggtggttgatcggcaac CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg Protospacer
******* **************.**. **...
928. spacer 4.1|839169|34|NZ_CP009426|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
caacggcgggcccggcgggtggttgatcggcaac CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg Protospacer
******* **************.**. **...
929. spacer 4.1|839169|34|NZ_CP009426|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.735
caacggcgggcccggcgggtggttgatcggcaac CRISPR spacer
caacggccggcccggcgggtggctgggcgatgcg Protospacer
******* **************.**. **...
930. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP010616 (Phaeobacter inhibens strain P92 plasmid pP92_f, complete sequence) position: , mismatch: 9, identity: 0.71
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg Protospacer
* ** *.******************. .
931. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP010635 (Phaeobacter inhibens strain P78 plasmid pP78_f, complete sequence) position: , mismatch: 9, identity: 0.71
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg Protospacer
* ** *.******************. .
932. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 9, identity: 0.71
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
cctcggcgggatcgccacgctgttcgacatg Protospacer
.******** *****.********.*..
933. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP010755 (Phaeobacter inhibens strain P70 plasmid pP70_f, complete sequence) position: , mismatch: 9, identity: 0.71
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg Protospacer
* ** *.******************. .
934. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP010713 (Phaeobacter inhibens strain P66 plasmid pP66_h, complete sequence) position: , mismatch: 9, identity: 0.71
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg Protospacer
* ** *.******************. .
935. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NZ_CP010740 (Phaeobacter inhibens strain P72 plasmid pP72_e, complete sequence) position: , mismatch: 9, identity: 0.71
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
cgacgccaggaacgccatgctgttcgagctg Protospacer
* ** *.******************. .
936. spacer 4.4|839349|31|NZ_CP009426|CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 9, identity: 0.71
ggccggcgggaacgccatgctgttcggcgcc CRISPR spacer
tttcggcgggaacgccatgccgatcgctatc Protospacer
.*****************.* *** ...*
937. spacer 4.6|839445|34|NZ_CP009426|CRT matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggaaacgccggcatgctgttcggcgcc CRISPR spacer
agccggcgcaaacgccggcaggctgcacctcgtg Protospacer
.******* *********** ****. * **.
938. spacer 4.6|839445|34|NZ_CP009426|CRT matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggaaacgccggcatgctgttcggcgcc CRISPR spacer
tgcccgcggatacgccggcatgctggctcgcgag Protospacer
*** ***** ************** .. ***
939. spacer 4.6|839445|34|NZ_CP009426|CRT matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggaaacgccggcatgctgttcggcgcc CRISPR spacer
agccggcgcaaacgccggcaggctgcacctcgtg Protospacer
.******* *********** ****. * **.
940. spacer 4.7|839502|31|NZ_CP009426|CRT matches to NZ_CP046571 (Xanthomonas albilineans strain Xa-FJ1 plasmid pXaFJ1, complete sequence) position: , mismatch: 9, identity: 0.71
attctcgaacggcggtgccaccggcggggca CRISPR spacer
cttctcaatcggcggtgccaccggtaccggc Protospacer
*****.* ***************.. *
941. spacer 5.8|927015|30|NZ_CP009426|CRT matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 9, identity: 0.7
cggattcggcggattccgcggcggggaggg CRISPR spacer
tggatccggtggattccgcggcggccgcat Protospacer
.****.***.************** . .
942. spacer 5.15|927315|30|NZ_CP009426|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
943. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
944. spacer 5.17|927411|30|NZ_CP009426|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
945. spacer 5.19|927501|27|NZ_CP009426|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 9, identity: 0.667
gctgatcggcaacggcggtaacggcgg--------- CRISPR spacer
---------caacggcggtaacggcggtaacggcgg Protospacer
******************
946. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
947. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
948. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
949. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
950. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
951. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
952. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
953. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
954. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
ggtggcggggccggcggcaccggcgggatcttcg Protospacer
.*.**************.* *******..* *
955. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
ggcggcgggtccggcggtaacggcggtttcttca Protospacer
.******** *********.****** .* *
956. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
atcggcgcggccggcggtaccggcgggaagtatg Protospacer
* ***** *********** *******. *.
957. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
ggcggcggcgccggcggtaacggcggcgtgggca Protospacer
.******* **********.****** *. ..*
958. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
aaaggcggggccggcgctcgcggcgggctgcacg Protospacer
*. ************* * ******** . **
959. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcg---gggccaact CRISPR spacer
tcgggcgcgcccggcggtagcggcgggcgggccg--- Protospacer
**** * *************** *****.
960. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcg---gggccaact CRISPR spacer
tcgggcgcgcccggcggtagcggcgggcgggccg--- Protospacer
**** * *************** *****.
961. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_011893 (Methylobacterium nodulans ORS 2060 plasmid pMNOD03, complete sequence) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
tacggcggggccggcgggggcggcggcggcggcg Protospacer
.*************** .******* * *..*
962. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
tcgggcggggccggcggcggcggcgggatcgcct Protospacer
**************..********..*. **
963. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to MK494105 (Mycobacterium phage Pinnie, complete genome) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
cccggcggcgccggcggtagtggcggaaccgaag Protospacer
****** ***********.*****..**.*
964. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 9, identity: 0.735
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
tcgggcggggccggcggcggcggcgggatcgcct Protospacer
**************..********..*. **
965. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
966. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
967. spacer 1.6|366485|33|NZ_CP009426|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
968. spacer 5.2|926727|39|NZ_CP009426|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
969. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
970. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
971. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
972. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
973. spacer 7.10|1571171|31|NZ_CP009426|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
974. spacer 7.13|1571420|34|NZ_CP009426|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
975. spacer 11.9|3097042|35|NZ_CP009426|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
976. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
gacggcggagccggcggaagcggcggccacgccg Protospacer
..******.******** ******** *. *
977. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 10, identity: 0.706
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcac Protospacer
. .********************.** ** .
978. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 10, identity: 0.706
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
gctggcggggccggcggtagcggtggcgcgtcac Protospacer
. .********************.** ** .
979. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
caaggcgggtccggcgctagcggcgggctgcacg Protospacer
. ****** ****** ********** . **
980. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 10, identity: 0.706
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
agcggcggcgccggcggcagcggccaaacgcagg Protospacer
******** ********.****** ...* *
981. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 10, identity: 0.706
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
ggcggcggtgccggcggcagcggcgagcagggcg Protospacer
.******* ********.*******.* ..*
982. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to MK510999 (Pseudomonas phage BR58, partial genome) position: , mismatch: 10, identity: 0.706
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
cctagcaaggccggcggtagcggcggttccaagg Protospacer
..**..****************** ****
983. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 11, identity: 0.676
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
cccggcggggccggcggcaacggcggcatcgcac Protospacer
***************.*.****** ..*. .
984. spacer 14.3|3918205|34|NZ_CP009426|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 11, identity: 0.676
agcggcggggccggcggtagcggcggggccaact CRISPR spacer
aacggcgggcccggcggtaacggcggcagtggtg Protospacer
*.******* *********.****** . ....