1. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
2. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
4. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
5. spacer 7.15|1571266|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 7.15|1571266|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 7.15|1571266|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 7.15|1571266|22|NZ_CP009427|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
9. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
10. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
11. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
12. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
13. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
14. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
15. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
16. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
17. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
18. spacer 6.15|1208264|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
19. spacer 7.2|1570339|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
20. spacer 7.2|1570339|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
21. spacer 7.2|1570339|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
22. spacer 7.2|1570339|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
23. spacer 7.2|1570339|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
24. spacer 7.3|1570393|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
25. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
26. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
27. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
28. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
29. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
30. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
31. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
32. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
33. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
34. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
35. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
36. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
37. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
38. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
39. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
40. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
41. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
42. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
43. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
44. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
45. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
46. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
47. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
48. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
49. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
50. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
51. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_019339 (Arthrobacter sp. J3-49 plasmid pJ349-116, complete sequence) position: , mismatch: 2, identity: 0.926
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccgccaccagcaccgccgg Protospacer
******** **********.*******
52. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 2, identity: 0.926
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgcgccttc Protospacer
************************. *
53. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
54. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
55. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
56. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
57. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
58. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
59. spacer 4.16|922921|24|NZ_CP009427|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
60. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
61. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
62. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
63. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
64. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
65. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
66. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
67. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
68. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
69. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
70. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
71. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
72. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
73. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
74. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
75. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
76. spacer 6.7|1207880|22|NZ_CP009427|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
77. spacer 6.11|1208063|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
78. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
79. spacer 7.4|1570447|22|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
80. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
81. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
82. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
83. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
84. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
85. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
86. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
87. spacer 7.15|1571266|22|NZ_CP009427|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
88. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 3, identity: 0.889
accaccgatgccgcggataccgccgtt CRISPR spacer
accgccgacgccgcggataccgccgtc Protospacer
***.****.*****************.
89. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.889
accaccgatgccgcggataccgccgtt CRISPR spacer
accaccgatgccgaggatgccgccgtg Protospacer
************* ****.*******
90. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
91. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
92. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
93. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
94. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
95. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
96. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
97. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacaccgccgtcgccgccgat Protospacer
.*************** ********.*
98. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacaccgccgtcgccgccgat Protospacer
.*************** ********.*
99. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccgacaccgcccgcgccgccggc Protospacer
******.******** **********.
100. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_014157 (Salinibacter ruber M8 plasmid pSR84, complete sequence) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
acctccaacaccgccgccgccgccgct Protospacer
*** ************ ******** *
101. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK448236 (Klebsiella phage ST899-OXA48phi17.1, complete genome) position: , mismatch: 3, identity: 0.889
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccagcaccgccgccgccgccgct Protospacer
*******.******** ******** *
102. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccaccatcaccgccgc Protospacer
***************** *.******
103. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccaccatcaccgccgc Protospacer
***************** *.******
104. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cagcgccgacgccgccagcgccgccga Protospacer
** **********.************.
105. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MN369759 (Mycobacterium phage Mithril, complete genome) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cagcgccgacgccgccagcgccgccga Protospacer
** **********.************.
106. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cagcgccgacgccgccagcgccgccga Protospacer
** **********.************.
107. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgacagcagcgccgcccg Protospacer
*********** ** ********** *
108. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_015851 (Acidithiobacillus caldus SM-1 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cagtgccgacgccaccagcaccgccgg Protospacer
** .***************.*******
109. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccaccgacgccaccagcggcgccag Protospacer
****.*************** ****.*
110. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP026329 (Acidithiobacillus caldus strain MTH-04 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cagtgccgacgccaccagcaccgccgg Protospacer
** .***************.*******
111. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgccgccatcgccgccgg Protospacer
*.***********.*** *********
112. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
ctccgccgacgccacgagcaccgccgg Protospacer
* ************* ***.*******
113. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgacagcagcgccgcccg Protospacer
*********** ** ********** *
114. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccgccaccaccgccgccag Protospacer
******** ******** *******.*
115. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgccgccatcgccgccgg Protospacer
*.***********.*** *********
116. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccaccgacgccaccagcgccgccag Protospacer
*.**.********************.*
117. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
ccccgccgacgccgccagcgcggccgg Protospacer
* ***********.******* *****
118. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.889
caccgccgacgccaccagcgccgccgg CRISPR spacer
cacggccgacgccgccagcgccgcctg Protospacer
*** *********.*********** *
119. spacer 10.5|2095748|24|NZ_CP009427|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
120. spacer 10.5|2095748|24|NZ_CP009427|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
121. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 3, identity: 0.889
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgcgctttc Protospacer
***********************.. *
122. spacer 1.1|365674|27|NZ_CP009427|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
123. spacer 1.1|365674|27|NZ_CP009427|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
124. spacer 1.7|366070|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
125. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
126. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
127. spacer 4.10|922636|27|NZ_CP009427|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
128. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
129. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
130. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
131. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
132. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
133. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
134. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
135. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
136. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
137. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
138. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
139. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
140. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
141. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
142. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
143. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
144. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
145. spacer 4.16|922921|24|NZ_CP009427|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
146. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
147. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
148. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
149. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
150. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
151. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
152. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
153. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
154. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
155. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
156. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
157. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
158. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
159. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
160. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
161. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
162. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
163. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
164. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
165. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
166. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
167. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
168. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
169. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
170. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
171. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
172. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
173. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
174. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
175. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
176. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
177. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
178. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
179. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
180. spacer 7.14|1571209|25|NZ_CP009427|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
181. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 4, identity: 0.852
accaccgatgccgcggataccgccgtt CRISPR spacer
aacaccgatgccgccgatacccccgat Protospacer
* ************ ****** *** *
182. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 4, identity: 0.852
accaccgatgccgcggataccgccgtt CRISPR spacer
aacaccgatgccgccgatacccccgat Protospacer
* ************ ****** *** *
183. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
184. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacgccgccggcgccgccgcc Protospacer
.********.*************** .
185. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
186. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
ctggccaacaccgccggcggcgccggt Protospacer
. **************** *******
187. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
188. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
189. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
tccgccgacaccgccggcgccgccgcc Protospacer
*****.****************** .
190. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacaccgccggtgccgccgca Protospacer
.****************.*******
191. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccgccgccgccgcc Protospacer
******* ******** ******** .
192. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaacaccgacggcaccgccgtc Protospacer
************* ****.****** .
193. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccatcaccgccggcaccgccgag Protospacer
******* **********.******.
194. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccgccgccgccgcc Protospacer
******* ******** ******** .
195. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccatcaccgccagcgccgccgcc Protospacer
******* *******.********* .
196. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
197. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
198. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
199. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
200. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
201. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccgccgccgccgcc Protospacer
******* ******** ******** .
202. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
203. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
204. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
205. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgcccgcgccgccggt Protospacer
****.******** ***********
206. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP030366 (Salinibacter ruber strain M1 plasmid pSR66, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
acctccaacaccgccgccgccgccgcc Protospacer
*** ************ ******** .
207. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggtgccgccgtc Protospacer
******* *********.******* .
208. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK967387 (Mycobacterium phage Big3, complete genome) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccgccgccgccgta Protospacer
******* ******** ********
209. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH155876 (Mycobacterium phage Priamo, complete genome) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcaccgccgaa Protospacer
******* **********.******.
210. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to JN020140 (Mycobacterium virus MrGordo, complete genome) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccgccgccgccgta Protospacer
******* ******** ********
211. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to KC661275 (Mycobacterium phage HINdeR, complete genome) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgcctgcgccgccgtc Protospacer
******* ******* ********* .
212. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK494105 (Mycobacterium phage Pinnie, complete genome) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
tccgccactaccgccggcgccgccggg Protospacer
****** .*****************
213. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN586039 (Mycobacterium phage Blinn1, complete genome) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcaccgccgaa Protospacer
******* **********.******.
214. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacaccgccgccgccgcggat Protospacer
.*************** ****** *.*
215. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
tcggccgataccgccggcgccgccggt Protospacer
* ***.*.******************
216. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacgccgccgccgccgccgat Protospacer
.********.****** ********.*
217. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccgccgccggcgccgccgct Protospacer
.****** *.*************** *
218. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacgccgccgccgccgccgat Protospacer
.********.****** ********.*
219. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
acccccaataccgccggcgccgccaga Protospacer
*** ****.***************.*
220. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
atagccaataccgcgggcgccgccggt Protospacer
*. *****.***** ************
221. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
atagccaataccgcgggcgccgccggt Protospacer
*. *****.***** ************
222. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_008739 (Marinobacter hydrocarbonoclasticus VT8 plasmid pMAQU02, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
acggggcacaccgccggcgccgccggt Protospacer
** * ********************
223. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP048426 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
ccggccaatgccgccggcgccgccggt Protospacer
* *****..*****************
224. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
ccggccaatgccgccggcgccgccggt Protospacer
* *****..*****************
225. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaacaccgccgaggccgcccat Protospacer
****************. ****** .*
226. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacgccgccgccgccgccgat Protospacer
.********.****** ********.*
227. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP053345 (Herbiconiux sp. SALV-R1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
atcgccatcaccgccggcaccgccggc Protospacer
*.***** **********.*******.
228. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacaccgctgtcgccgccgat Protospacer
.*************.* ********.*
229. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacgccgccgccgccgccgat Protospacer
.********.****** ********.*
230. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacgccgccgccgccgccgat Protospacer
.********.****** ********.*
231. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt CRISPR spacer
agccccaacaccgccgccgtcgccggt Protospacer
* * ************ **.*******
232. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP011297 (Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt-- CRISPR spacer
gccgccaacaccgccggcgtcg--ggtca Protospacer
.******************.** ***
233. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 4, identity: 0.852
accgccaacaccgccggcgccgccggt-- CRISPR spacer
gccgccaacaccgccggcgtcg--ggtca Protospacer
.******************.** ***
234. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
-accgccaacaccgccggcgccgccggt CRISPR spacer
cagccccag-accgccggcgccgccggt Protospacer
* * ***. ******************
235. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
-accgccaacaccgccggcgccgccggt CRISPR spacer
cagccccag-accgccggcgccgccggt Protospacer
* * ***. ******************
236. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
-accgccaacaccgccggcgccgccggt CRISPR spacer
cagccccag-accgccggcgccgccggt Protospacer
* * ***. ******************
237. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
-accgccaacaccgccggcgccgccggt CRISPR spacer
cagccccag-accgccggcgccgccggt Protospacer
* * ***. ******************
238. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
-accgccaacaccgccggcgccgccggt CRISPR spacer
cagccccag-accgccggcgccgccggt Protospacer
* * ***. ******************
239. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 4, identity: 0.852
gccttggccgcccagcaggctgatcag CRISPR spacer
gcagaggccgcccagaaggctgatcag Protospacer
** ********** ***********
240. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 4, identity: 0.852
gccttggccgcccagcaggctgatcag CRISPR spacer
gcagaggccgcccagaaggctgatcag Protospacer
** ********** ***********
241. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 4, identity: 0.852
gccttggccgcccagcaggctgatcag CRISPR spacer
gcagaggccgcccagaaggctgatcag Protospacer
** ********** ***********
242. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 4, identity: 0.852
gccttggccgcccagcaggctgatcag CRISPR spacer
gcaaaggccgcccagaaggctgatcag Protospacer
** ********** ***********
243. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.852
gccttggccgcccagcaggctgatcag CRISPR spacer
gggttcgccgcgcagcaggctgatcag Protospacer
* ** ***** ***************
244. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
gccttggccgcccagcaggctgatcag CRISPR spacer
gcagaggccgcccagaaggctgatcag Protospacer
** ********** ***********
245. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
246. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
aaccgccgtcgccagcagcgccgccgc Protospacer
******* ***** ***********
247. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP046571 (Xanthomonas albilineans strain Xa-FJ1 plasmid pXaFJ1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccgccaccaccgccgcctc Protospacer
******** ******** *******
248. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
249. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccaccaccagcgccgccac Protospacer
******** *.**************.
250. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgccggtgccaccagcgccgccgg Protospacer
..******..*****************
251. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
252. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
253. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH727550 (Corynebacterium phage Juicebox, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
catcgccgacgccacccgcgccgccaa Protospacer
**.************* ********..
254. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccagcagcgccggctc Protospacer
************** ******** *
255. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgacgccggcgccaccatcgccgccgg Protospacer
*. *****.******** *********
256. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
257. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccaccaccagcgccgccac Protospacer
******** *.**************.
258. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
259. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
260. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
261. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
262. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
263. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
264. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
265. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
266. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
267. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
268. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
269. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
270. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
271. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
272. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
273. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
274. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
275. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
276. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
277. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
278. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
279. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
280. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
281. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
282. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
283. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
284. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
285. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
286. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
287. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
288. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
289. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
290. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
291. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
292. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
293. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
294. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
295. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
296. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
297. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
298. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
299. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
300. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
301. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MT658803 (Mycobacterium phage Reindeer, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccgccaccaccgccgccac Protospacer
******** ******** *******.
302. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MN693028 (Marine virus AFVG_117M90, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgtcgccaccaccgccgccat Protospacer
******** ******** *******.
303. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KJ019071 (Synechococcus phage ACG-2014g isolate Syn7803US105, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
taccgccgccgccaccaccgccgccgc Protospacer
.******* ******** ********
304. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP054921 (Streptomyces sp. NA03103 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
ccccgccgacggcacccgcgccgccga Protospacer
* ********* **** *********.
305. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccagcgccaccgc Protospacer
*.****** *************.***
306. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
307. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
308. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgccacccgcgacgccga Protospacer
*.************** *** *****.
309. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
310. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
311. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
312. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
313. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
314. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
315. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
316. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgccacccgcgacgccga Protospacer
*.************** *** *****.
317. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacaccaccaccgccgccga Protospacer
*.********.****** ********.
318. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccggcgccagcagcgccgccgc Protospacer
*.******.***** ***********
319. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
gatcgccggcgccaccagcgccgcctg Protospacer
*.*****.**************** *
320. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgcctacgccaccaacgccgccga Protospacer
*.***** *********.********.
321. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccga Protospacer
*.*****.*********.********.
322. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccga Protospacer
*.*****.*********.********.
323. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgcctacgccaccaacgccgccga Protospacer
*.***** *********.********.
324. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgcctacgccaccaacgccgccga Protospacer
*.***** *********.********.
325. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccga Protospacer
*.*****.*********.********.
326. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccagcgccaccgc Protospacer
*.****** *************.***
327. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccacccgcgcctcggc Protospacer
**************** ***** * *
328. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgcccccagcgccgccgc Protospacer
*.****** **** ************
329. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccgc Protospacer
*.****** ******** ********
330. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP025805 (Sulfitobacter sp. SK012 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
-caccgccgacgccaccagcgccgccgg CRISPR spacer
ccagtg-cgacgccaccagcgccgccga Protospacer
** .* ********************.
331. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgccacccgcgacgccga Protospacer
*.************** *** *****.
332. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccagcgccaccgc Protospacer
*.****** *************.***
333. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MK814750 (Gordonia phage Ewald, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
gatcgccgagcccaccagcgccgccgg Protospacer
*.****** ****************
334. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MK686071 (Streptomyces phage Mischief19, complete genome) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgccaccggcgccgacgt Protospacer
*.**************.****** **
335. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 4, identity: 0.852
caccg-ccgacgccaccagcgccgccgg CRISPR spacer
-gccgcccgacgccagcagcgccgccgc Protospacer
.*** ********* ***********
336. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 4, identity: 0.852
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccaccgccgccaccagcgccgccag Protospacer
*.**.*** ****************.*
337. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 4, identity: 0.852
cgccttggccgcccagcaggctgatca CRISPR spacer
cgcagaggccgcccagaaggctgatca Protospacer
*** ********** **********
338. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 4, identity: 0.852
cgccttggccgcccagcaggctgatca CRISPR spacer
cgcaaaggccgcccagaaggctgatca Protospacer
*** ********** **********
339. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
cgccttggccgcccagcaggctgatca CRISPR spacer
cgcagaggccgcccagaaggctgatca Protospacer
*** ********** **********
340. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 4, identity: 0.852
cgccttggccgcccagcaggctgatca CRISPR spacer
cgcagaggccgcccagaaggctgatca Protospacer
*** ********** **********
341. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 4, identity: 0.852
cgccttggccgcccagcaggctgatca CRISPR spacer
cgcagaggccgcccagaaggctgatca Protospacer
*** ********** **********
342. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.852
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccatggccgcgcagcaggctgtcca Protospacer
**** ******* ********** .**
343. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.852
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccatggccgcgcagcaggctgtcca Protospacer
**** ******* ********** .**
344. spacer 10.5|2095748|24|NZ_CP009427|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
345. spacer 10.5|2095748|24|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
346. spacer 10.5|2095748|24|NZ_CP009427|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
347. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gagcggcggcagcggcggcgcgcccgt Protospacer
* **********************..
348. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gatcggcggcagcggcggcgcgcacat Protospacer
* .******************** **.
349. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gatcggcggcagcggcggcgcgcacat Protospacer
* .******************** **.
350. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gatcggcggcagcggcggcgcgcacat Protospacer
* .******************** **.
351. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggctgctgcggcgcgcccgg Protospacer
********** ** ***********.
352. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggctgctgcggcgcgcccgg Protospacer
********** ** ***********.
353. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to CP000664 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggccggggcggcgcgcccag Protospacer
********* * *************
354. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
taccggcggcaccggcggctcgcccac Protospacer
********* ******* *******
355. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gatcggcggcagcggcggcgcgcacat Protospacer
* .******************** **.
356. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgccgtctc Protospacer
********************* .* *
357. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gatcggcggcagcggcggcgcgcacat Protospacer
* .******************** **.
358. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gatcggcggcagcggcggcgcgcacat Protospacer
* .******************** **.
359. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgccgtctc Protospacer
********************* .* *
360. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN892486 (Mycobacterium phage KilKor, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
361. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN908683 (Mycobacterium phage StressBall, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
362. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN892484 (Mycobacterium phage CactusJack, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
363. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MT498061 (Mycobacterium phage Jung, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
364. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN807249 (Mycobacterium phage Megiddo, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
365. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_026605 (Mycobacterium phage Malithi, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
366. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN807250 (Mycobacterium phage Glaske, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
367. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN807248 (Mycobacterium phage Phalm, complete genome) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcggcggcgcgctgcc Protospacer
**********.************. *
368. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
369. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
370. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
371. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
372. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
373. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
374. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
375. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
376. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
377. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
378. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
379. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
380. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
381. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
382. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
383. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
384. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
385. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
386. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
387. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
388. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
389. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
390. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
391. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
392. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
393. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
394. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
395. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
396. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
397. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
398. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
399. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
400. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
401. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
402. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
403. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
404. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
405. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
406. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
407. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
408. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
409. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
410. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
411. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
412. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
413. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
414. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
415. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
416. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
417. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
418. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
419. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
420. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
421. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
422. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
423. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
424. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
425. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
426. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
427. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
428. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgcgatgac Protospacer
* ******************** . **
429. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP040251 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcgcccgcggcggcgcgctgac Protospacer
******** * ************. **
430. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP040252 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcgcccgcggcggcgcgctgac Protospacer
******** * ************. **
431. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcatcggcggcgcgacctc Protospacer
* ********* ********** ** *
432. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.852
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcatcggcggcgcgacctc Protospacer
* ********* ********** ** *
433. spacer 1.1|365674|27|NZ_CP009427|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
434. spacer 1.1|365674|27|NZ_CP009427|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
435. spacer 1.7|366070|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
436. spacer 1.7|366070|27|NZ_CP009427|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
437. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
438. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
439. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
440. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
441. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
442. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
443. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
444. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
445. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
446. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
447. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
448. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
449. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
450. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
451. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
452. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
453. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
454. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
455. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
456. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
457. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
458. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
459. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
460. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
461. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
462. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
463. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
464. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
465. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
466. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
467. spacer 4.5|922426|27|NZ_CP009427|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
468. spacer 4.5|922426|27|NZ_CP009427|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
469. spacer 4.5|922426|27|NZ_CP009427|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
470. spacer 4.5|922426|27|NZ_CP009427|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
471. spacer 4.5|922426|27|NZ_CP009427|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
472. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
473. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
474. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
475. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
476. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
477. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
478. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
479. spacer 4.10|922636|27|NZ_CP009427|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
480. spacer 4.10|922636|27|NZ_CP009427|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
481. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
482. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
483. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
484. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
485. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
486. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
487. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
488. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
489. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
490. spacer 4.15|922873|30|NZ_CP009427|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
491. spacer 4.16|922921|24|NZ_CP009427|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
492. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
493. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
494. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
495. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
496. spacer 6.4|1207700|25|NZ_CP009427|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
497. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
498. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
499. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
500. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
501. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
502. spacer 7.5|1570501|25|NZ_CP009427|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
503. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
504. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
505. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
506. spacer 7.13|1571143|34|NZ_CP009427|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
507. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
ggcaccgatgccgcggctgccgccggt Protospacer
. ************** *.****** *
508. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
ggcaccgatgccgcgggaaccgccggt Protospacer
. **************. ******* *
509. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NZ_CP042572 (Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
ggcaccgatgccgcggcttccgccggt Protospacer
. ************** * ****** *
510. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
511. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
512. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
513. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
514. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
515. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
516. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
517. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MK977707 (Mycobacterium phage LilSpotty, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
518. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
519. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
520. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
521. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
522. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
523. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
cgcaccggtgccgccgataccgccggt Protospacer
*****.****** ********** *
524. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.815
accaccgatgccgcggataccgccgtt CRISPR spacer
ggcaccgatgccgcggctgccgccggt Protospacer
. ************** *.****** *
525. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.833
ggcaccga--tcgtggagccggctccgccggt CRISPR spacer
--tagcgatttcgtcgagccggctccgccggt Protospacer
.* *** **** *****************
526. spacer 8.14|1631642|27|NZ_CP009427|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
aagagcgctgagggcctggttgccggg Protospacer
* ***.***.***************
527. spacer 8.14|1631642|27|NZ_CP009427|CRT matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
tgcggcgatgaaggccgggttgccggg Protospacer
* *** ******** **********
528. spacer 8.14|1631642|27|NZ_CP009427|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
aagagcgctgagggcctggttgccggg Protospacer
* ***.***.***************
529. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
tccgccatcaccgccgccgccgccgac Protospacer
****** ******** ********..
530. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP048070 (Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
531. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039088 (Piscirickettsia salmonis strain Psal-111 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
532. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039113 (Piscirickettsia salmonis strain Psal-135 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
533. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039093 (Piscirickettsia salmonis strain Psal-114 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
534. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039172 (Piscirickettsia salmonis strain Psal-138 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
535. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013797 (Piscirickettsia salmonis strain AY6532B plasmid p1PS9, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
536. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013976 (Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
537. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP012511 (Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-3, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
538. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgcc Protospacer
.****** ******** ******** .
539. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgcc Protospacer
.****** ******** ******** .
540. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgcc Protospacer
.****** ******** ******** .
541. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgcc Protospacer
.****** ******** ******** .
542. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgcc Protospacer
.****** ******** ******** .
543. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
caggccaaggccgccggcgccgccggt Protospacer
***** .*****************
544. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013824 (Piscirickettsia salmonis strain PM25344B plasmid p3PS14, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
545. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013804 (Piscirickettsia salmonis strain PM22180B plasmid p3PS13, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
546. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039869 (Piscirickettsia salmonis strain Psal-113 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
547. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013820 (Piscirickettsia salmonis strain AY3800B plasmid p4PS10, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
548. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013780 (Piscirickettsia salmonis strain PM51819A plasmid p2PS5, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
549. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013792 (Piscirickettsia salmonis strain AY6297B plasmid p1PS8, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
550. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013815 (Piscirickettsia salmonis strain AY3864B plasmid p4PS11, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
551. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039239 (Piscirickettsia salmonis strain BI1 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
552. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039245 (Piscirickettsia salmonis strain MR5 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
553. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039071 (Piscirickettsia salmonis strain Psal-108 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
554. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039103 (Piscirickettsia salmonis strain Psal-118 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
555. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039177 (Piscirickettsia salmonis strain Psal-139 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
556. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaaggccgccggcgccgccgcc Protospacer
.******* .*************** .
557. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039108 (Piscirickettsia salmonis strain Psal-134 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
558. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039051 (Piscirickettsia salmonis strain Psal-081 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
559. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013946 (Piscirickettsia salmonis strain PSCGR01 plasmid pPsCRG01-1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
560. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039056 (Piscirickettsia salmonis strain Psal-098 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
561. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039078 (Piscirickettsia salmonis strain Psal-109 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
562. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039082 (Piscirickettsia salmonis strain Psal-110 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
563. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP012417 (Piscirickettsia salmonis strain PM15972A1 plasmid pPSA1-4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
564. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP038919 (Piscirickettsia salmonis strain Psal-010b plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
565. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccatcaccgccggcaccgccacc Protospacer
******* **********.*****. .
566. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP038899 (Piscirickettsia salmonis strain Psal-006b plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
567. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP048053 (Piscirickettsia salmonis strain Ps-11091B plasmid Ps11091B-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
568. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaaggccgccggcgccgccgcc Protospacer
.******* .*************** .
569. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN693489 (Marine virus AFVG_25M400, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacagcgccggcaccgccgcc Protospacer
.********* *******.****** .
570. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039213 (Piscirickettsia salmonis strain Psal-103 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
571. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039061 (Piscirickettsia salmonis strain Psal-099 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
572. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP038897 (Piscirickettsia salmonis strain Psal-006a plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
573. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP038905 (Piscirickettsia salmonis strain Psal-008 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
574. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP038928 (Piscirickettsia salmonis strain Psal-013 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
575. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039200 (Piscirickettsia salmonis strain Psal-161 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
576. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013771 (Piscirickettsia salmonis strain PM23019A plasmid p3PS3, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
577. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013787 (Piscirickettsia salmonis strain PM58386B plasmid p1PS7, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
578. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
cccgccaaccccgccagcgccgccgac Protospacer
******** *****.*********..
579. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013767 (Piscirickettsia salmonis strain PM21567A plasmid p5PS2, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
580. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039228 (Piscirickettsia salmonis strain SR1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
581. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013775 (Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
582. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP050946 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p8, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
583. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gacgccaacaccgtcgccgccgccggc Protospacer
. ***********.** *********.
584. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP011850 (Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
585. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039206 (Piscirickettsia salmonis strain Psal-182 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
586. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039098 (Piscirickettsia salmonis strain Psal-117 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
587. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_011982 (Agrobacterium vitis S4 plasmid pTiS4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
cccgcctacaccgccgccgccgccgcc Protospacer
***** ********* ******** .
588. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP039047 (Piscirickettsia salmonis strain Psal-073 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
589. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP038912 (Piscirickettsia salmonis strain Psal-009 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
590. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013807 (Piscirickettsia salmonis strain PM31429B plasmid p1PS12, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
591. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP048060 (Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p4, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
592. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013782 (Piscirickettsia salmonis strain PM49811B plasmid p1PS6, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgtgaat Protospacer
******* **************. ..*
593. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_KY000075 (Agrobacterium vitis strain CFBP2681 plasmid pTi_CFBP2681, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
cccgcctacaccgccgccgccgccgcc Protospacer
***** ********* ******** .
594. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN585999 (Mycobacterium phage Briton15, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgta Protospacer
.****** ******** ********
595. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_042326 (Mycobacterium virus KSSJEB, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgta Protospacer
.****** ******** ********
596. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN735434 (Mycobacterium phage Mangeria, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgca Protospacer
.****** ******** ********
597. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MG872833 (Mycobacterium phage BeesKnees, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgta Protospacer
.****** ******** ********
598. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN693270 (Marine virus AFVG_25M401, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacagcgccggcaccgccgcc Protospacer
.********* *******.****** .
599. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_024136 (Mycobacterium phage Seabiscuit, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgta Protospacer
.****** ******** ********
600. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN444869 (Mycobacterium phage DreamCatcher, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgta Protospacer
.****** ******** ********
601. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH020244 (Mycobacterium phage Lopton, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccgta Protospacer
.****** ******** ********
602. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccgccgccggcgccgcggcc Protospacer
******* *.************* * .
603. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccggaaacaccgccggcgccgcccgc Protospacer
.*** ****************** *.
604. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccatcgccgccggcgccgcccgc Protospacer
.****** *.************** *.
605. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP026974 (Achromobacter insolitus strain FDAARGOS_88 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccgccgccgcacgc Protospacer
******* ******** ****** *.
606. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccatcaccgccgtcgccgccagc Protospacer
.****** ******** *******.*.
607. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccatcaccgccggcaccgcggag Protospacer
******* **********.**** *.
608. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP010721 (Phaeobacter piscinae strain P18 plasmid pP18_f, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgccagcaccgccggagccgccgcg Protospacer
* *****.********* *******
609. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacaccgccgccggcgccagc Protospacer
.*************** ** ****.*.
610. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccagcgccgccggcgccgccagc Protospacer
.******.*.**************.*.
611. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccatcaccgccggcaccgcggag Protospacer
******* **********.**** *.
612. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccatcaccgccggcaccgcggag Protospacer
******* **********.**** *.
613. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
ccgaccaatgccgccggcgccgccggt Protospacer
* .****..*****************
614. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
acggcgaacaccgccggcgccgcggtc Protospacer
** ** ***************** * .
615. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
cccgccaacgccgcccgcgccgccagg Protospacer
********.***** ********.*
616. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
cccgccaacgccgcccgcgccgccagg Protospacer
********.***** ********.*
617. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
tcggccaccaccgccggcgcccccggc Protospacer
* **** ************* ****.
618. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccgacaccgccggcgtcgccctt Protospacer
.*****.************.**** *
619. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP044073 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gcgcccatcaccgcctgcgccgccggt Protospacer
.* *** ******* ***********
620. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
621. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
622. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
623. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
624. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
625. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MG757164 (Mycobacterium phage PhenghisKhan, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
626. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MG757165 (Mycobacterium phage Phergie, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
627. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK524486 (Mycobacterium phage Waleliano, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
628. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
629. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
630. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
631. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
632. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
633. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
634. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
635. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
636. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
637. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN304822 (Phage 64_12, partial genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
gcatcgaacgccgccggcgccgccggt Protospacer
.* * ***.*****************
638. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
639. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
640. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
641. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
642. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
643. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH155874 (Mycobacterium phage PhrankReynolds, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
644. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
645. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
646. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
647. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
648. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
649. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
650. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
651. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
652. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
653. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
654. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
aacgcgaacaccgccgccgccgccgcc Protospacer
* *** ********** ******** .
655. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgcctgcgccgccgaa Protospacer
* ****.******** *********.
656. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_028968 (Mycobacterium phage BrownCNA, complete genome) position: , mismatch: 5, identity: 0.815
accgccaacaccgccggcgccgccggt CRISPR spacer
agcgccgacaccgccagcgccgccgaa Protospacer
* ****.********.*********.
657. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.815
gccttggccgcccagcaggctgatcag CRISPR spacer
aggttcgccgcgcagcaggctgatcag Protospacer
. ** ***** ***************
658. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.815
gccttggccgcccagcaggctgatcag CRISPR spacer
aggttcgccgcgcagcaggctgatcag Protospacer
. ** ***** ***************
659. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
gccttggccgcccagcaggctgatcag CRISPR spacer
gggttcgccgcgcagcaggctgatcaa Protospacer
* ** ***** **************.
660. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_AP022623 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_2) position: , mismatch: 5, identity: 0.815
gccttggccgcccagcaggctgatcag CRISPR spacer
gcgctggccgcccaccaggctgatctc Protospacer
** .********** **********
661. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
gccttggccgcccagcaggctgatcag CRISPR spacer
gggttcgccgcgcagcaggctgatcaa Protospacer
* ** ***** **************.
662. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
gccttggccgcccagcaggctgatcag CRISPR spacer
gatctggccgcccggcaggctggtcag Protospacer
* ..*********.********.****
663. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NC_021278 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815
gccttggccgcccagcaggctgatcag CRISPR spacer
gcgctggccgcccaccaggctgatctc Protospacer
** .********** **********
664. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
665. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
666. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
667. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
668. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
gcccgccgacggcaccggcgccgccgt Protospacer
********* ****.*********
669. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
670. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
agcccccgacgccaccaccgccgccga Protospacer
.** ************ ********.
671. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
672. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
673. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
gcttgccgacgccaccagcgcggccgg Protospacer
..***************** *****
674. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
675. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
676. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
677. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
678. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
679. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
680. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
681. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
682. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
683. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
684. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
685. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
686. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
687. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
688. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
689. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
690. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
691. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
692. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
693. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
694. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
695. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
696. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
697. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
698. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
699. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
700. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
701. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
702. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
703. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
704. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
705. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
706. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
707. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
708. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
709. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
710. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
711. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
712. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
713. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccggcgcaaccagcgccgccgt Protospacer
.******.*** *************
714. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
715. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgccgacgccacccgtgccgccga Protospacer
..************** *.*******.
716. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccaccggcaccgcatt Protospacer
****************.**.****
717. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccaccgccgccac Protospacer
*.****** ******** *******.
718. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
719. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgccgccgccaccagcgccgctag Protospacer
..****** ***************..*
720. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ttccgccgacgccatcagcgccggcag Protospacer
. ************.******** *.*
721. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccgccgccagcgccgcacc Protospacer
******** ****.**********
722. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
723. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
aaccgccgccgccagcagcgccgccca Protospacer
******* ***** ********** .
724. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgccaccatcgccgcgat Protospacer
*.*************** ****** .
725. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
726. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
727. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
728. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccaccggcaccgcatt Protospacer
****************.**.****
729. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
730. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
731. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
aaccgccgccgccagcagcgccgccca Protospacer
******* ***** ********** .
732. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
733. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cggcgccgacgccaccggcgccgcccc Protospacer
*. *************.********
734. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgccgccgccaccagcgccgctag Protospacer
..****** ***************..*
735. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ttccgccgacgccatcagcgccggcag Protospacer
. ************.******** *.*
736. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
aaccgccgccgccagcagcgccgccca Protospacer
******* ***** ********** .
737. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccggcgccaccaccgccgccgg Protospacer
. *****.******** *********
738. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cttcgccgacggcagcagcgccgccga Protospacer
* .******** ** ***********.
739. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
740. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
741. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
742. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccaccggcaccgcatt Protospacer
****************.**.****
743. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccaccagcgccgcacc Protospacer
*.****** ***************
744. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ccgtcccgacgccaccagcgccgccag Protospacer
* . ********************.*
745. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcacgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
746. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
acccgccgacgccaccggtgccgccga Protospacer
**************.*.*******.
747. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
aaccgccgccgccagcagcgccgccca Protospacer
******* ***** ********** .
748. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgcgccgacgccgcccgcgccgccgg Protospacer
. **********.** **********
749. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
gaccgccgccgccatcagcgccgcctc Protospacer
******* *****.**********
750. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MN369748 (Mycobacterium phage Miko, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgccgccgccgccagcgccgccgc Protospacer
..****** ****.************
751. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KJ538722 (Mycobacterium phage HH92, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
752. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KT222940 (Mycobacterium phage Kinbote, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
753. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MK801735 (Mycobacterium Phage Rachaly, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgccgccgccgccagcgccgccgc Protospacer
..****** ****.************
754. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MK919482 (Mycobacterium phage DeepSoil15, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
755. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MT657330 (Mycobacterium phage Webster2, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
756. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MF919517 (Mycobacterium phage LilHazelnut, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
757. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tggcgccggcgccaccagcgccgcggg Protospacer
.. *****.*************** **
758. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to EU203571 (Mycobacterium phage Giles, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
759. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
760. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MT818421 (Mycobacterium phage Luke, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
761. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH697577 (Mycobacterium phage Amochick, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
762. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MT684594 (Mycobacterium phage Hadrien, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
763. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MF324899 (Mycobacterium phage Lokk, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgccgccgccgccagcgccgccgc Protospacer
..****** ****.************
764. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MT114159 (Mycobacterium phage Ein37, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
765. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
agccgccggcgccacccgcgccgccga Protospacer
.******.******* *********.
766. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KT246485 (Mycobacterium phage OBUpride, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
767. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KT454972 (Mycobacterium phage Evanesce, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccaccaccgccgccgc Protospacer
.****** ******** ********
768. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cctggccgacgccgcccgcgccgccgg Protospacer
* . *********.** **********
769. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccagcatcgccgtctc Protospacer
************** ** *****.*
770. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ccccggcgacgccacccgcgccgccaa Protospacer
* *** ********** ********..
771. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
acccgccgccgccaccagcgcggcctg Protospacer
****** ************ *** *
772. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgccgccacgagcgccgccac Protospacer
*.****** ****** *********.
773. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgcctccagccccgccct Protospacer
*.*********** ***** *****
774. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgacgccatcatcgccgcctg Protospacer
.************.** ******* *
775. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
gaccgccgacgtcacccgcgccgcggt Protospacer
**********.**** ******* *
776. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
gcccgccaacgccagcagcgccgccag Protospacer
*****.****** **********.*
777. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccgacgacaccggcgccgcccc Protospacer
*.********* ****.********
778. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgatgcccgcgccaccagcgccgccgg Protospacer
*. .*** .******************
779. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022304 (Thalassococcus sp. S3 plasmid pS3A, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacgccaccaccgtcgaaga Protospacer
***************** **.** *.
780. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP038257 (Microbacterium sediminis strain YLB-01 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cacccccgtcgccaccagcgccgtgtg Protospacer
**** *** **************. *
781. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
ccgcgccgccgccaccagccccgccgc Protospacer
* ***** ********** ******
782. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
gagcgccgacgccaccaccgtcgccga Protospacer
* ************** **.*****.
783. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH697582 (Mycobacterium phage Ejimix, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgcctacgccaccaacgccgccaa Protospacer
*.***** *********.*******..
784. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH697582 (Mycobacterium phage Ejimix, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
785. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
786. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
787. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KM400683 (Mycobacterium phage Ariel, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
788. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MT521998 (Gordonia phage Jambalaya, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacaccaccagcgacgactc Protospacer
**********.********* ** *
789. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MF919534 (Mycobacterium phage Superphikiman, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
790. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_023690 (Mycobacterium phage Courthouse, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
791. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_028953 (Mycobacterium phage MiaZeal, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
792. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MH834627 (Arthrobacter phage Ryan, complete genome) position: , mismatch: 5, identity: 0.815
caccgccg----acgccaccagcgccgccgg CRISPR spacer
----gcgggagaacgccaccagcgccgccgg Protospacer
** * *******************
793. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MF668284 (Mycobacterium phage Squint, complete genome) position: , mismatch: 5, identity: 0.815
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgccgccaacgccaccaacgccgccaa Protospacer
*.*****.*********.*******..
794. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttggccgccaagcaggccgagac Protospacer
************* *******.**
795. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca CRISPR spacer
agggttcgccgcgcagcaggctgatca Protospacer
* ** ***** **************
796. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca CRISPR spacer
agggttcgccgcgcagcaggctgatca Protospacer
* ** ***** **************
797. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP029542 (Streptomyces sp. NEAU-S7GS2 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccatggccgcccagcaggccaacct Protospacer
**** ****************..*.*
798. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NC_021278 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca CRISPR spacer
tgcgctggccgcccaccaggctgatct Protospacer
.** .********** **********
799. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP025409 (Paracoccus sp. BM15 plasmid pBM151, complete sequence) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca- CRISPR spacer
tgccttggccgcccagcagg-taacgac Protospacer
.******************* *.*. *
800. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca CRISPR spacer
agggttcgccgcgcagcaggctgatca Protospacer
* ** ***** **************
801. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_AP022623 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_2) position: , mismatch: 5, identity: 0.815
cgccttggccgcccagcaggctgatca CRISPR spacer
tgcgctggccgcccaccaggctgatct Protospacer
.** .********** **********
802. spacer 16.4|3950545|36|NZ_CP009427|CRT matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 5, identity: 0.861
--ggccggcggtagcagcggtgccggcagcaccaacgg CRISPR spacer
agggccggag--agcagcggtgccgccagcaccaccgg Protospacer
****** * ************* ******** ***
803. spacer 16.15|3951379|27|NZ_CP009427|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gtccggcggtagcggcggggccaacct CRISPR spacer
ggccggcggtatcggcgggcccaactg Protospacer
* ********* ******* *****.
804. spacer 16.15|3951379|27|NZ_CP009427|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.815
gtccggcggtagcggcggggccaacct CRISPR spacer
ggccggcggtatcggcgggcccaactg Protospacer
* ********* ******* *****.
805. spacer 16.15|3951379|27|NZ_CP009427|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
gtccggcggtagcggcggggccaacct CRISPR spacer
gtccgacggcagcggcggggccagcgg Protospacer
*****.***.*************.*
806. spacer 16.17|3951514|27|NZ_CP009427|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
ggtcggaggaaaaggcggcaccaacgg CRISPR spacer
cggcggcggaaaaggcggaaccaacgc Protospacer
* *** *********** *******
807. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggcgcgggcgg Protospacer
* ******************** *.
808. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcgggagcggcggcgcgcgccg Protospacer
*** ***** ************* *
809. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcgggagcggcggcgcgcgccg Protospacer
*** ***** ************* *
810. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cagcggcggcagcggcggcgcgccgcc Protospacer
********************* *
811. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggcagcggcggcgagccggg Protospacer
******************* *** .
812. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcagcggcggcgcgggcct Protospacer
*** ****************** * .
813. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcagcggcggcgcgggcct Protospacer
*** ****************** * .
814. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggcagcggcggtgcgccgca Protospacer
*****************.*****
815. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
816. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
817. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccctgcggcatcggcggcgcgccggg Protospacer
**** ****** ************ .
818. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
819. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gggcggcggcagcggcagcgcggccaa Protospacer
* *************.***** ***
820. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
821. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gggcggcggcagcggcagcgcggccaa Protospacer
* *************.***** ***
822. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccagcggcagcggcggcgcggaaag Protospacer
****.***************** *
823. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
824. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcggcggcggcgcgccggt Protospacer
* ********.************* ..
825. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
826. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP013454 (Burkholderia vietnamiensis strain MSMB608WGS plasmid pMSMB608, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagccgccgcgcgccgcg Protospacer
************* ** *******
827. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
828. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
829. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gggcggcggcagcggcagcgcggccaa Protospacer
* *************.***** ***
830. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
831. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gggcggcggcagcggcagcgcggccaa Protospacer
* *************.***** ***
832. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
833. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
834. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP040824 (Paraoceanicella profunda strain D4M1 plasmid pD4M1F, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccctgcggcatcggcggcgcgccggg Protospacer
**** ****** ************ .
835. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
836. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
837. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
838. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gtcgagcggcagcggccgcgcgcccag Protospacer
*.* .*********** *********
839. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
840. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
841. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
842. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
843. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
844. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
845. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
846. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggtgcgggttc Protospacer
******************.*** . *
847. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcggcggcggcgcgccggg Protospacer
* ********.************* .
848. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
849. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
850. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
851. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
852. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
853. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
854. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
855. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
856. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
857. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
858. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
859. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
860. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
861. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
862. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
863. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gccgggcggcatcggcggcgcgcgcct Protospacer
*** ******* *********** * .
864. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_010879 (Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cggcggcggccgcggcggcgcgccgac Protospacer
******* ************* **
865. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcacggcggcaccggcggcgcgccgct Protospacer
** ******** ************ .
866. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MF324912 (Mycobacterium phage Phrank, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
taacggcggcaacggcggcgcgaccac Protospacer
********.********** ****
867. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ctccggcagcagcggcggcgcgccgat Protospacer
.*****.**************** *.
868. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN329673 (Gordonia phage Jabberwocky, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ctccggcagcagcggcggcgcgccgat Protospacer
.*****.**************** *.
869. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ctccggcagcagcggcggcgcgccgat Protospacer
.*****.**************** *.
870. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN369762 (Mycobacterium phage Bryler, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
taacggcggcaacggcggcgcgaccac Protospacer
********.********** ****
871. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ctccggcagcagcggcggcgcgccgat Protospacer
.*****.**************** *.
872. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MF324913 (Mycobacterium phage Cain, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
taacggcggcaacggcggcgcgaccac Protospacer
********.********** ****
873. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
actcggcggcagcggcggcgcggcgat Protospacer
.*.******************* * *.
874. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
875. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
876. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggccgcggcgccgcgcccgt Protospacer
* ******** ****** *******..
877. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccagcggcagcggcggcgccgacag Protospacer
****.**************** **
878. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcagcgcatccgg Protospacer
****************.****..**.
879. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggccgcggcggcggcgcgcgcgt Protospacer
******* **.************ *..
880. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
881. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
882. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
aaccggcggcatcggcggcgcgacctc Protospacer
. ********* ********** ** *
883. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gttcggcggcagcggcgtcccgcccag Protospacer
*..************** * ******
884. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
885. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggcagtggcggcgagccatc Protospacer
***********.******* *** *
886. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
887. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
888. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
889. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggccggcggcagcggcggcgccctggc Protospacer
* ******************* *. .*
890. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggccgcaccggcggcgcgcgagc Protospacer
******* *** *********** .*
891. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
892. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggctgcagcggcagcgcgcggcc Protospacer
******* ********.****** *
893. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaagggcggcagcggcggcgccaccac Protospacer
* ***************** ****
894. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
895. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
896. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggcagtggcggcgagccatc Protospacer
***********.******* *** *
897. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
898. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
899. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
900. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
901. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
902. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
903. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcggcagcggcgcgcagcc Protospacer
**********.**.********* *
904. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
905. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP012267 (Cronobacter dublinensis subsp. dublinensis LMG 23823 plasmid pCDU1, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcgacggcggcgcgcacgt Protospacer
**********..*********** *..
906. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP011276 (Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggtcggcggcggcggcggcgggcccaa Protospacer
* .*******.********* *****
907. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gggccgcggcagcggcggcgcgccgcc Protospacer
* * ******************* *
908. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP031753 (Rhodobacter sphaeroides strain EBL0706 plasmid p.B, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggccggggcggcgcgccgag Protospacer
********* * *********** *
909. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
910. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
911. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gaccggcggcagcggcggctcgtccgg Protospacer
* ***************** **.**.
912. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gtccggcggcaacggcggcgcgtccgg Protospacer
*.*********.**********.**.
913. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MH539650 (Siphoviridae sp. isolate ctcf5, complete genome) position: , mismatch: 5, identity: 0.815
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggctaccggcagcggcggcgcgcccgc Protospacer
* *.. *******************.*
914. spacer 1.1|365674|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
915. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
916. spacer 1.7|366070|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
917. spacer 1.9|366220|27|NZ_CP009427|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
918. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
919. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
920. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
921. spacer 1.10|366280|27|NZ_CP009427|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
922. spacer 2.1|579594|36|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 6, identity: 0.833
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcaccacccgcttgcgggggaggatcgaacg Protospacer
***************************..* * .*
923. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
924. spacer 4.5|922426|27|NZ_CP009427|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
925. spacer 4.5|922426|27|NZ_CP009427|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
926. spacer 4.5|922426|27|NZ_CP009427|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
927. spacer 4.5|922426|27|NZ_CP009427|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
928. spacer 4.5|922426|27|NZ_CP009427|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
929. spacer 4.5|922426|27|NZ_CP009427|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
930. spacer 4.5|922426|27|NZ_CP009427|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
931. spacer 4.5|922426|27|NZ_CP009427|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
932. spacer 4.10|922636|27|NZ_CP009427|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
933. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
934. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
935. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
936. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
937. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
938. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
939. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
940. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
941. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
942. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
943. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
944. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
945. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
946. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
947. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
948. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
949. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
950. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
951. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
952. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
953. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
954. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
955. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
956. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
957. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
958. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
959. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
960. spacer 4.15|922873|30|NZ_CP009427|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
961. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
962. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
963. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
964. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
965. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
966. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
967. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
968. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
969. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
970. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
971. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
972. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
973. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
974. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
975. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
976. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
977. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
978. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
979. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
980. spacer 4.15|922873|30|NZ_CP009427|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
981. spacer 4.17|922963|36|NZ_CP009427|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
982. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
983. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
984. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
985. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
986. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
987. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
988. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
989. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
990. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
991. spacer 7.13|1571143|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
992. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.778
accaccgatgccgcggataccgccgtt CRISPR spacer
ggcaccgatgccgcggctgccgccgac Protospacer
. ************** *.****** .
993. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.778
accaccgatgccgcggataccgccgtt CRISPR spacer
aaacgcgatgccgccgataccgccgta Protospacer
* ********* ***********
994. spacer 8.1|1630955|27|NZ_CP009427|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.778
accaccgatgccgcggataccgccgtt CRISPR spacer
tacaccgctgccgcggagaccgccgac Protospacer
***** ********* ******* .
995. spacer 8.2|1631000|30|NZ_CP009427|CRT matches to KF692088 (Arthrobacter phage vB_ArS-ArV2, complete genome) position: , mismatch: 6, identity: 0.8
tccatcgccgccgttatcgaacgtgccctt CRISPR spacer
gacatcgccgtcgttatcgaacgtcgccgt Protospacer
********.************* ** *
996. spacer 8.14|1631642|27|NZ_CP009427|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778
acctgcgttgaaggcctggttgccggg CRISPR spacer
gcgcacgtcgaaggcctggttgccggc Protospacer
.* ..***.*****************
997. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgcccacaccgccagcgccgccata Protospacer
.***** ********.********.
998. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccacc Protospacer
.****** ******** *******. .
999. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaccaccgccgccgccgccacc Protospacer
.****** ******** *******. .
1000. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaccaccgccggcgccgatccc Protospacer
******* ************** . .
1001. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
ggcgccaccaccgccggcgccgccacc Protospacer
. ***** ****************. .
1002. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaacaccgccgccgcccgcacc Protospacer
**************** **** *. .
1003. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP015742 (Shinella sp. HZN7 plasmid pShin-06, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
gacggcaacaccgcccgcgccgccgcg Protospacer
. ** ********** *********
1004. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
ggcgccaacgccgccagcgccgccgac Protospacer
. *******.*****.*********..
1005. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccgacaccgccgccgccgccgcc Protospacer
****.********* ******** .
1006. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_001759 (Streptomyces phaeochromogenes plasmid pJV1, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
gacgccgtcaccgccggcgccgccgag Protospacer
. ****. *****************.
1007. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
accgccaacatcgccgacgccgcgatc Protospacer
**********.*****.****** . .
1008. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
tccgccaccaccgccgacgccgccacg Protospacer
****** ********.*******.
1009. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
cgcaccaccaccgccggcgccgccgtc Protospacer
*.*** ***************** .
1010. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
ggtgccttcaccgccggcgccgccgga Protospacer
. .*** ******************
1011. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
gatgccaacaccgtcgccgccgccggc Protospacer
. .**********.** *********.
1012. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
ggcgccaggaccgccggcgccgccgtc Protospacer
. *****. **************** .
1013. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP022670 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR5, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
ggtgccttcaccgccggcgccgccgga Protospacer
. .*** ******************
1014. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
tccgccgacaccgccggtgccgccaac Protospacer
*****.**********.******...
1015. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MK359331 (Mycobacterium phage Rajelicia, complete genome) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
tgcgccaccaccgccgccgccgccgta Protospacer
***** ******** ********
1016. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN119379 (Mycobacterium phage Anglerfish, complete genome) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
tgcgccaccaccgccgccgccgccgta Protospacer
***** ******** ********
1017. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_031004 (Gordonia phage Nyceirae, complete genome) position: , mismatch: 6, identity: 0.778
accgccaacaccgccggcgccgccggt CRISPR spacer
gttgccgagaccgccggcgccgccggc Protospacer
...***.* *****************.
1018. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 6, identity: 0.778
gccttggccgcccagcaggctgatcag CRISPR spacer
gccttggccgccaagcaggccgagacc Protospacer
************ *******.**
1019. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.778
gccttggccgcccagcaggctgatcag CRISPR spacer
aggctcgccgcgcagcaggctgatcag Protospacer
. .* ***** ***************
1020. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gccttggccgcccagcaggctgatcag CRISPR spacer
caggttgccgcccagcaggcggatcag Protospacer
* ************** ******
1021. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778
gccttggccgcccagcaggctgatcag CRISPR spacer
ggtgccgccgcgcagcaggctgatcag Protospacer
* . . ***** ***************
1022. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.778
gccttggccgcccagcaggctgatcag CRISPR spacer
tgcaatgccgcccagcaggccgatcag Protospacer
* **************.******
1023. spacer 9.4|1635243|27|NZ_CP009427|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.778
cacctgcgttgaaggcctggttgccgg CRISPR spacer
ccggcgcgtagaaggcctggttgccgc Protospacer
* .**** ****************
1024. spacer 9.4|1635243|27|NZ_CP009427|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778
cacctgcgttgaaggcctggttgccgg CRISPR spacer
ggcgcacgtcgaaggcctggttgccgg Protospacer
.* ..***.*****************
1025. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacaccgccagcgccgagca Protospacer
**********.**.********* .
1026. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
gtaggccgacgccagcagcgccgcctg Protospacer
********** ********** *
1027. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacaccgccagcgccgagca Protospacer
**********.**.********* .
1028. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgtcgccgacgccgacagcgccgccgc Protospacer
...**********. ***********
1029. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
gctcgacgacgccaccatcgccgccgc Protospacer
.** *********** ********
1030. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacaccgccagcgccgagca Protospacer
**********.**.********* .
1031. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgagccgacgcctccagcgccgccga Protospacer
. ********* ************.
1032. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
cgaggccgacgccaccggcgccgcctc Protospacer
*. ************.********
1033. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
cggcgccggcgccaccagcgccgcgac Protospacer
*. *****.*************** .
1034. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgcgtacgccaccagcgccgccac Protospacer
..**** *****************.
1035. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgcgtacgccaccagcgccgccac Protospacer
..**** *****************.
1036. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgccgcgtacgccaccagcgccgccac Protospacer
..**** *****************.
1037. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
gctcgccgccgccaccatcgccgccgc Protospacer
.***** ******** ********
1038. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgccgccacccgcgccgggtc Protospacer
******** ******* ******
1039. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
caccgccgacaccgccagcgccgagca Protospacer
**********.**.********* .
1040. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggcccccgccgccaccagcgccgccac Protospacer
.** *** ****************.
1041. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_007950 (Polaromonas sp. JS666 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
ggccgccgccgccagcagcgccgcctt Protospacer
.****** ***** **********
1042. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
gcccgccgccgtcaccagcgccgcccc Protospacer
****** **.*************
1043. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NC_019376 (Sphingobium fuliginis ATCC 27551 plasmid pPDL2, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
gtcggccgacgccaccagcgccggcaa Protospacer
* ******************* *..
1044. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_MK439385 (Agrobacterium tumefaciens strain Kerr27 plasmid pTiKerr27, complete sequence) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
tgaagccgacgccaccttcgccgccgg Protospacer
.. ************ *********
1045. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
actcggcgacgccgccagcgccgccgc Protospacer
.** *******.************
1046. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to KY092482 (Streptomyces phage Mojorita, complete genome) position: , mismatch: 6, identity: 0.778
caccgccgacgccaccagcgccgccgg CRISPR spacer
gttcgccgacgtcacccgcgccgccga Protospacer
.********.**** *********.
1047. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
aaggttcgccgcgcagcaggctgatca Protospacer
. ** ***** **************
1048. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttggccggccagcaggatggcag Protospacer
*********** ******** **.. .
1049. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccatcgccgcccagcaggctgtcgg Protospacer
**** * **************** . .
1050. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttggccggccagcaggatggcag Protospacer
*********** ******** **.. .
1051. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
aaggttcgccgcgcagcaggctgatca Protospacer
. ** ***** **************
1052. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttggccggccagcaggatggcag Protospacer
*********** ******** **.. .
1053. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to MF324915 (Mycobacterium phage Amgine, complete genome) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttggccgcgcagcaggcgatgct Protospacer
************ ******** . *
1054. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttcgccacccagcaggctgtcgt Protospacer
****** ***.************ .
1055. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttcgccgccaagcaggctgtcgt Protospacer
****** ****** ********* .
1056. spacer 9.6|1635333|27|NZ_CP009427|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 6, identity: 0.778
cgccttggccgcccagcaggctgatca CRISPR spacer
cgccttggccggccagcaggatggcag Protospacer
*********** ******** **.. .
1057. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
1058. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 6, identity: 0.818
caacgccggcaccggcggcgccatcg----gctccgg CRISPR spacer
caacgccggcgccggcggcgccatcatgccgct---- Protospacer
**********.**************. ***
1059. spacer 16.15|3951379|27|NZ_CP009427|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.778
gtccggcggtagcggcggggccaacct CRISPR spacer
tcccggcggcagcggcggggccgacaa Protospacer
.*******.************.**
1060. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcgcctcgcggta Protospacer
***************** * ***
1061. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
caacggcggcagcggcggcgcgctggc Protospacer
********************. .*
1062. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgcttggtt Protospacer
********************* . .
1063. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgcctggtt Protospacer
********************* . .
1064. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgcctggtt Protospacer
********************* . .
1065. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgcctggtt Protospacer
********************* . .
1066. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcagcggcggcgcctggtt Protospacer
********************* . .
1067. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
catgggcgacagcggcggcgcgcccat Protospacer
. ****.*****************.
1068. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
catgggcgacagcggcggcgcgcccat Protospacer
. ****.*****************.
1069. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
catgggcgacagcggcggcgcgcccat Protospacer
. ****.*****************.
1070. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
catgggcgacagcggcggcgcgcccat Protospacer
. ****.*****************.
1071. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cggcggcggcagccgcggcgcgccccg Protospacer
********** ***********
1072. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgtcggcggcagcggcggcgcggccgg Protospacer
.******************* **.
1073. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
catgggcgacagcggcggcgcgcccat Protospacer
. ****.*****************.
1074. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggcatcggcggcgcgggcga Protospacer
********** ********** *.
1075. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
caccggcggcatcggcggcgcgctggc Protospacer
********* ***********. .*
1076. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
caccggcggcggcggcggcgagccctt Protospacer
********.********* **** .
1077. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcatcggcggcgtgctggt Protospacer
*********** ********.**. ..
1078. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgctggcggcagcggcggcgagcccgt Protospacer
*.**************** ****..
1079. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
caccggcggcatcggcggcgcgctggc Protospacer
********* ***********. .*
1080. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggccgaggcggcgcgcgtct Protospacer
********** * ********** . .
1081. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gtccggcggcagcggcggcgcctctgg Protospacer
*.******************* .*..
1082. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
acccggcggcaccggcggcgcgggcgg Protospacer
.********** ********** *.
1083. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggcatcggcggcgcgggcga Protospacer
********** ********** *.
1084. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcgcggcggcagcggcggcgctggcgg Protospacer
** ****************** *.
1085. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gctcggcggcagcggcgtcgcgcttga Protospacer
**.************** *****...
1086. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_022050 (Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggcggcatcggcggcacgcttta Protospacer
*********** *******.***..
1087. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
gcccggccgcaccggcggcgcgcatgt Protospacer
******* *** *********** ...
1088. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcgaccgg Protospacer
********.*********** **.
1089. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1090. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1091. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1092. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
agccggcggcagcggcggcacgctcgg Protospacer
. *****************.***.*.
1093. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1094. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcgaccgg Protospacer
********.*********** **.
1095. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
taccggcggcaacggcagcgcgcccga Protospacer
*********.****.********.
1096. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcgaccgg Protospacer
********.*********** **.
1097. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1098. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_028974 (Streptomyces phage YDN12, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ccccggcggcagcggcggcccggaccg Protospacer
****************** ** *
1099. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcgaccgg Protospacer
********.*********** **.
1100. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1101. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1102. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcgaccgg Protospacer
********.*********** **.
1103. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcggccta Protospacer
********.*********** **
1104. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 6, identity: 0.778
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cgccggcggcggcggcggcgcgaccgg Protospacer
********.*********** **.
1105. spacer 1.4|365869|27|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
1106. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1107. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1108. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1109. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1110. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1111. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1112. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1113. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1114. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1115. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1116. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1117. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1118. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1119. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1120. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1121. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
1122. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
1123. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1124. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1125. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
1126. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1127. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1128. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
1129. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1130. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1131. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1132. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1133. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1134. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1135. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
1136. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
1137. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1138. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1139. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1140. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1141. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1142. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1143. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
1144. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1145. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1146. spacer 4.13|922777|30|NZ_CP009427|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1147. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1148. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1149. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1150. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1151. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1152. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1153. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1154. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1155. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1156. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1157. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1158. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1159. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1160. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1161. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1162. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1163. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1164. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1165. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1166. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1167. spacer 4.13|922777|30|NZ_CP009427|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1168. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1169. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1170. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1171. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1172. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1173. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1174. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1175. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1176. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1177. spacer 4.13|922777|30|NZ_CP009427|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1178. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1179. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1180. spacer 4.13|922777|30|NZ_CP009427|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1181. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1182. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1183. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1184. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1185. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1186. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1187. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1188. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1189. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1190. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1191. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1192. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1193. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1194. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1195. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1196. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1197. spacer 4.13|922777|30|NZ_CP009427|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1198. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1199. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1200. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1201. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1202. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1203. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1204. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
1205. spacer 4.13|922777|30|NZ_CP009427|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
1206. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
1207. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
1208. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
1209. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
1210. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
1211. spacer 4.13|922777|30|NZ_CP009427|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
1212. spacer 4.13|922777|30|NZ_CP009427|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
1213. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
1214. spacer 4.13|922777|30|NZ_CP009427|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
1215. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
1216. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
1217. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
1218. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1219. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1220. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1221. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1222. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1223. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1224. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1225. spacer 4.15|922873|30|NZ_CP009427|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
1226. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1227. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1228. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1229. spacer 4.15|922873|30|NZ_CP009427|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
1230. spacer 4.15|922873|30|NZ_CP009427|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
1231. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1232. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
1233. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1234. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1235. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
1236. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
1237. spacer 4.17|922963|36|NZ_CP009427|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
1238. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
1239. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
1240. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
1241. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
1242. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
1243. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
1244. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
1245. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
1246. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
1247. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
1248. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1249. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1250. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1251. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1252. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1253. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1254. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1255. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1256. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1257. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
1258. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
1259. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
1260. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
1261. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
1262. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
1263. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
1264. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
1265. spacer 6.9|1207964|37|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
1266. spacer 7.1|1570279|28|NZ_CP009427|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
1267. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
1268. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
1269. spacer 8.2|1631000|30|NZ_CP009427|CRT matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 7, identity: 0.767
tccatcgccgccgttatcgaacgtgccctt CRISPR spacer
gccatcgccgccgtcatcgagcgtggacga Protospacer
*************.*****.**** *
1270. spacer 8.2|1631000|30|NZ_CP009427|CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 7, identity: 0.767
tccatcgccgccgttatcgaacgtgccctt CRISPR spacer
gccatcgccgccgtcatcgagcgtggacga Protospacer
*************.*****.**** *
1271. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to MH155867 (Gordonia phage Easley, complete genome) position: , mismatch: 7, identity: 0.767
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
cgcaccgatcgtggagtcggcgccgaggcc Protospacer
***************.**** *** * .
1272. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
gacaccgatcgtcgagccggcgccggccaa Protospacer
*.********** ******** *** * .
1273. spacer 8.14|1631642|27|NZ_CP009427|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.741
acctgcgttgaaggcctggttgccggg CRISPR spacer
cggcgcgtagaaggcctggttgccgcc Protospacer
.**** ****************
1274. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_008242 (Chelativorans sp. BNC1 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.741
accgccaacaccgccggcgccgccggt CRISPR spacer
cgtgatctcaccgccggcgccgccggt Protospacer
.* . *******************
1275. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NZ_CP021016 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6991 plasmid pF, complete sequence) position: , mismatch: 7, identity: 0.741
accgccaacaccgccggcgccgccggt CRISPR spacer
gccgccaacaccgccagcgccgtgtca Protospacer
.**************.******.
1276. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MG757157 (Gordonia phage Flapper, complete genome) position: , mismatch: 7, identity: 0.741
accgccaacaccgccggcgccgccggt CRISPR spacer
tacgccaacaccgccggagccgcgctc Protospacer
*************** ***** .
1277. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP025409 (Paracoccus sp. BM15 plasmid pBM151, complete sequence) position: , mismatch: 7, identity: 0.741
gccttggccgcccagcaggctgatcag CRISPR spacer
gccttggccgcccagcaggtaacgacg Protospacer
*******************. . *
1278. spacer 8.16|1631732|27|NZ_CP009427|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.741
gccttggccgcccagcaggctgatcag CRISPR spacer
caggggaacgcccagcaggctgatcag Protospacer
*. *******************
1279. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP035515 (Haematobacter massiliensis strain OT1 plasmid pOT1-5, complete sequence) position: , mismatch: 7, identity: 0.741
caccgccgacgccaccagcgccgccgg CRISPR spacer
tcgggccggcgccaccagcgccgcctc Protospacer
. ****.****************
1280. spacer 10.3|2095658|30|NZ_CP009427|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
1281. spacer 10.3|2095658|30|NZ_CP009427|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
1282. spacer 10.3|2095658|30|NZ_CP009427|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
1283. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
1284. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
1285. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1286. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1287. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1288. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1289. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1290. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1291. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1292. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1293. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
1294. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
1295. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
ggtctccggcgccggcggctccatcggctccga Protospacer
. * *****.******** ************.
1296. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
cgcggccggcaacggctgcgccatcggctcggt Protospacer
*. ******* **** ************* *
1297. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP042262 (Litoreibacter sp. LN3S51 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
cgaggccggcaccggcggcgtcatgggctgggc Protospacer
*.* ****************.*** **** *
1298. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
ccgcgccggcacctgcggcgccatccgccgtgg Protospacer
* .********** *********** **. .**
1299. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
catcgccggcatcggcggcgccatctacgccca Protospacer
** ********.************* .* ** .
1300. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
catcgccggcatcggcggcgccatctacgccca Protospacer
** ********.************* .* ** .
1301. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg-- CRISPR spacer
cgccgacggcagcggcggcgccatcgg--gcggct Protospacer
*. ** ***** *************** ***
1302. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 7, identity: 0.788
-caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gctgcacc-tcaccggcggcgccatcggcgacgg Protospacer
* .*.** ******************* ***
1303. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NC_014723 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH02, complete sequence) position: , mismatch: 7, identity: 0.788
caacgccggcaccggcggcgccatcggctccgg- CRISPR spacer
ggacgcaggcaccggcggcgccacc-gcgccgcc Protospacer
.**** ****************.* ** ***
1304. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggtcggcggcagcggcggcgcggtggt Protospacer
* .******************* . ..
1305. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
ggtcggcggcagcggcggcgcgggtgg Protospacer
* .******************* ..
1306. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cggtagcggtagcggcggcgcgcccat Protospacer
..****.****************.
1307. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
caccggcggcagcggcggcgccggcgg Protospacer
******************* *.
1308. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KX855962 (Arthrobacter phage HumptyDumpty, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1309. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MF185721 (Arthrobacter phage Kabreeze, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1310. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN204503 (Arthrobacter phage Linus, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1311. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MF185723 (Arthrobacter phage RosiePosie, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1312. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KX670787 (Arthrobacter phage Chocolat, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1313. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MF668274 (Arthrobacter phage JayCookie, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1314. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MK494107 (Arthrobacter phage Chipper1996, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1315. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MF185724 (Arthrobacter phage Scavito, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1316. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KX670786 (Arthrobacter phage Chubster, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1317. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN204499 (Arthrobacter phage Mordred, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1318. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MF185725 (Arthrobacter phage Tophat, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1319. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to KU160660 (Arthrobacter phage PrincessTrina, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
tgacggcggcggcggcggcgcgcctcg Protospacer
*******.*************.
1320. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 7, identity: 0.741
gcccggcggcagcggcggcgcgcccac CRISPR spacer
caccggcggcagcggcggcgcaggcgg Protospacer
*******************. *.
1321. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
1322. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
1323. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
1324. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
1325. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
1326. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
1327. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
1328. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
1329. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
1330. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
1331. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1332. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
1333. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
1334. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
1335. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1336. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1337. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
1338. spacer 4.13|922777|30|NZ_CP009427|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
1339. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1340. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1341. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1342. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1343. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
1344. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
1345. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
1346. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1347. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
1348. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
1349. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
1350. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1351. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1352. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1353. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1354. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1355. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1356. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1357. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
1358. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
1359. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
1360. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
1361. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
1362. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
1363. spacer 4.17|922963|36|NZ_CP009427|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
1364. spacer 4.17|922963|36|NZ_CP009427|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
1365. spacer 4.17|922963|36|NZ_CP009427|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
1366. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
1367. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
1368. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
1369. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
1370. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1371. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
1372. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1373. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
1374. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
1375. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1376. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
1377. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
1378. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
1379. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
1380. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
1381. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1382. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1383. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1384. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1385. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1386. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1387. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1388. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1389. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1390. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1391. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1392. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1393. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
1394. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
1395. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
1396. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
1397. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1398. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1399. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1400. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1401. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1402. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1403. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1404. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1405. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1406. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1407. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1408. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1409. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1410. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1411. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1412. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1413. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1414. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
1415. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1416. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
1417. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
1418. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1419. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
1420. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
1421. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
1422. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
1423. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
1424. spacer 6.9|1207964|37|NZ_CP009427|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
1425. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
1426. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1427. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1428. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1429. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1430. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1431. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1432. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
1433. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
1434. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
1435. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
1436. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP011044 (Clavibacter michiganensis subsp. insidiosus strain R1-1 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
cgacccgaccgtgcagccggctccgcctcc Protospacer
* ****.**** ************* .
1437. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1438. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP021035 (Clavibacter michiganensis subsp. insidiosus strain R1-3 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
cgacccgaccgtgcagccggctccgcctcc Protospacer
* ****.**** ************* .
1439. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP021039 (Clavibacter michiganensis subsp. insidiosus strain ATCC 10253 plasmid pCI1, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
cgacccgaccgtgcagccggctccgcctcc Protospacer
* ****.**** ************* .
1440. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1441. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1442. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1443. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1444. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1445. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1446. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1447. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1448. spacer 8.12|1631558|30|NZ_CP009427|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 8, identity: 0.733
ggcaccgatcgtggagccggctccgccggt CRISPR spacer
ggcaccgatcgtggcgccggccagcgcgcc Protospacer
************** ******. ** .
1449. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_023714 (Mycobacterium phage LinStu, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1450. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to GQ303262 (Mycobacterium phage LRRHood, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1451. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MT889395 (Mycobacterium phage Shifa, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1452. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MH910040 (Mycobacterium phage Sauce, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1453. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MN062707 (Mycobacterium phage Grungle, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1454. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to KX831080 (Mycobacterium phage Lukilu, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1455. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to NC_028869 (Mycobacterium phage HyRo, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1456. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to MF919513 (Mycobacterium phage Koguma, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1457. spacer 8.15|1631687|27|NZ_CP009427|CRT matches to JN204348 (Mycobacterium phage Sebata, complete genome) position: , mismatch: 8, identity: 0.704
---accgccaacaccgccggcgccgccggt CRISPR spacer
cgcgccaccaccgccgccgccgccgcc--- Protospacer
.**.*** *.****** *******
1458. spacer 10.3|2095658|30|NZ_CP009427|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1459. spacer 10.3|2095658|30|NZ_CP009427|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
1460. spacer 13.31|3132992|29|NZ_CP009427|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
1461. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
1462. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
1463. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
1464. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
1465. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP014516 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gatcgccggcgccggcggcgccatcggcctgct Protospacer
* *******.*****************..
1466. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
acccgccggcaccggcggcgccaacggatcgaa Protospacer
******************** *** ** ..
1467. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gggcgccggcgccggcggcgccgtcggcttctc Protospacer
..*******.***********.******.*
1468. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gctggccgacaccggcggcggcatcggctcggt Protospacer
****.*********** ********* *
1469. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
ggacgccggcatcgtcggcgccatcggcgcgct Protospacer
.*********.** ************* *
1470. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gcaagacggcacccgcggcgccatcggccccac Protospacer
* * ******* **************.**.
1471. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gcaagacggcacccgcggcgccatcggccccac Protospacer
* * ******* **************.**.
1472. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
taagcctcgcacgggcggcgccatcggcgccgc Protospacer
.** *. **** *************** ***
1473. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 8, identity: 0.758
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
cgccagctgcaccggcagcgccatccgctccga Protospacer
*. *. * ********.******** ******.
1474. spacer 16.18|3951577|27|NZ_CP009427|CRT matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 8, identity: 0.704
gcccggcggcagcggcggcgcgcccac CRISPR spacer
cggtggcggcagcggcggcgcgcaggg Protospacer
.******************* .
1475. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
1476. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1477. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1478. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
1479. spacer 2.1|579594|36|NZ_CP009427|CRISPRCasFinder matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 9, identity: 0.75
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcacctcccgctcgcgggggaccatcgccac Protospacer
********** ******.******** .* ** .
1480. spacer 2.1|579594|36|NZ_CP009427|CRISPRCasFinder matches to NZ_CP024892 (Rhodococcus ruber strain YYL plasmid pYYL1.1, complete sequence) position: , mismatch: 9, identity: 0.75
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcacctcccgctcgcgggggaccatcgccac Protospacer
********** ******.******** .* ** .
1481. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
1482. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1483. spacer 3.1|689944|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
1484. spacer 4.13|922777|30|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
1485. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1486. spacer 4.15|922873|30|NZ_CP009427|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
1487. spacer 4.17|922963|36|NZ_CP009427|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
1488. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
1489. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
1490. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
1491. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
1492. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
1493. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1494. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1495. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
1496. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1497. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
1498. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
1499. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
1500. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
1501. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1502. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
1503. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1504. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1505. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1506. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1507. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
1508. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1509. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1510. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
1511. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1512. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1513. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1514. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1515. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1516. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1517. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1518. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1519. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1520. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1521. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1522. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1523. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1524. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
1525. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1526. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1527. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
1528. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1529. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1530. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1531. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
1532. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1533. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1534. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1535. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
1536. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1537. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
1538. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
1539. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
1540. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
1541. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1542. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
1543. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1544. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1545. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
1546. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1547. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1548. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1549. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1550. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1551. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
1552. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1553. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
1554. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1555. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
1556. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
1557. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1558. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
1559. spacer 6.9|1207964|37|NZ_CP009427|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
1560. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
1561. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
1562. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
1563. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
1564. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
1565. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
1566. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
1567. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
1568. spacer 8.2|1631000|30|NZ_CP009427|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
tccatcgccgccgttatcgaacgtgccctt CRISPR spacer
gaagcaaccgccgttatccaacgcgccctt Protospacer
.. .*********** ****.******
1569. spacer 8.2|1631000|30|NZ_CP009427|CRT matches to MK069556 (Microcystis phage Me-ZS1, complete genome) position: , mismatch: 9, identity: 0.7
tccatcgccgccgttatcgaacgtgccctt CRISPR spacer
cacatcgccgaccttatcgaacgtggtgaa Protospacer
. ******** * ************ .
1570. spacer 9.3|1635189|36|NZ_CP009427|CRT matches to NZ_CP023524 (Burkholderia gladioli pv. gladioli strain FDAARGOS_389 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
tgcctccggccccgccggcgccggggtcaccgccat CRISPR spacer
agcgatcggcgccgccggcgccggggccaccgcggc Protospacer
** .**** ***************.****** ..
1571. spacer 9.3|1635189|36|NZ_CP009427|CRT matches to NZ_CP020932 (Marinobacter salarius strain SMR5 plasmid pSMR5, complete sequence) position: , mismatch: 9, identity: 0.75
tgcctccggccccgccggcgccggggt-caccgccat CRISPR spacer
cccctccggcaccgccagcgccggggtcctctgacg- Protospacer
. ******** *****.********** * *.* *.
1572. spacer 9.5|1635288|27|NZ_CP009427|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.667
---caccgccgacgccaccagcgccgccgg CRISPR spacer
gcgcgccgccgccaccagcgacgccgc--- Protospacer
*.****** *.*** *..******
1573. spacer 12.24|3130757|37|NZ_CP009427|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757
tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga Protospacer
** . . ***.************* **********
1574. spacer 13.17|3133648|39|NZ_CP009427|CRISPRCasFinder,CRT matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
tcaaaaacggggacggcatgctgcatgccctaacgtcgt---- CRISPR spacer
agaaaaacgaggacggcatgccgcatgcc----cgccgtccgc Protospacer
*******.***********.******* **.***
1575. spacer 13.40|3133652|39|NZ_CP009427|PILER-CR matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
tcaaaaacggggacggcatgctgcatgccctaacgtcgt---- CRISPR spacer
agaaaaacgaggacggcatgccgcatgcc----cgccgtccgc Protospacer
*******.***********.******* **.***
1576. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
1577. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
1578. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
1579. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1580. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1581. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1582. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1583. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1584. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
1585. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
1586. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1587. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1588. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1589. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
1590. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1591. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1592. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
1593. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
1594. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
1595. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc Protospacer
* ****************.***.****.
1596. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gatcgccggcaccggcggcaccaccggccagcc Protospacer
* ****************.***.****.
1597. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NC_016601 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED02, complete sequence) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
agtcgccggtgccggcggcgccatcggccgacg Protospacer
. ******..*****************. *
1598. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NC_009955 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence) position: , mismatch: 9, identity: 0.727
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gaaggccggcaccggcggcgcgatcaccgcgcc Protospacer
** ***************** ***. * *
1599. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1600. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1601. spacer 1.6|366004|33|NZ_CP009427|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
1602. spacer 2.1|579594|36|NZ_CP009427|CRISPRCasFinder matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 10, identity: 0.722
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggcacctcccgcgtgcgggggaacatcatttt Protospacer
********** ***** *********. .* .. .*
1603. spacer 4.2|922273|39|NZ_CP009427|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
1604. spacer 4.17|922963|36|NZ_CP009427|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
1605. spacer 4.17|922963|36|NZ_CP009427|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
1606. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
1607. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
1608. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
1609. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
1610. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
1611. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
1612. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1613. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
1614. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1615. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1616. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1617. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1618. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
1619. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1620. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1621. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
1622. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1623. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1624. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1625. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1626. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1627. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1628. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1629. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1630. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1631. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
1632. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1633. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1634. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1635. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1636. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1637. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1638. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1639. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1640. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1641. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1642. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1643. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1644. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1645. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1646. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1647. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1648. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1649. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1650. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1651. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
1652. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1653. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1654. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1655. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1656. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1657. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1658. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1659. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
1660. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1661. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1662. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1663. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1664. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1665. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1666. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
1667. spacer 6.9|1207964|37|NZ_CP009427|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1668. spacer 6.9|1207964|37|NZ_CP009427|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1669. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1670. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
1671. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
1672. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1673. spacer 7.10|1570894|31|NZ_CP009427|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
1674. spacer 7.13|1571143|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
1675. spacer 9.3|1635189|36|NZ_CP009427|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.722
tgcctccggccccgccggcgccggggtcaccgccat CRISPR spacer
cgtggtggccctcgcccgcgccggggtcaccgccac Protospacer
.*. . * **.**** ******************.
1676. spacer 9.3|1635189|36|NZ_CP009427|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.722
tgcctccggccccgccggcgccggggtcaccgccat CRISPR spacer
cgtggtggccctcgcccgcgccggggtcaccgccac Protospacer
.*. . * **.**** ******************.
1677. spacer 12.17|3130235|35|NZ_CP009427|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
1678. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
1679. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
1680. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
1681. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.697
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
tctcgccggcaccggccacgccatcggatagct Protospacer
. ************* .********* *
1682. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.697
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
tctcgccggcaccggccacgccatcggatagct Protospacer
. ************* .********* *
1683. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_CP040097 (Pantoea sp. SO10 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
agagaccggcaccagcggcggcatcggctggat Protospacer
.* .********.****** ******** .
1684. spacer 2.1|579594|36|NZ_CP009427|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 11, identity: 0.694
tgggggcaccacccgcttgcgggggagagtggcgct CRISPR spacer
tgggggtacctcccgcttgcgggggacgacctccgc Protospacer
******.*** *************** ... * .
1685. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
1686. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
1687. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1688. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1689. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
1690. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
1691. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
1692. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
1693. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
1694. spacer 6.5|1207748|40|NZ_CP009427|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
1695. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1696. spacer 16.7|3950773|36|NZ_CP009427|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1697. spacer 16.9|3950917|33|NZ_CP009427|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
1698. spacer 16.12|3951154|33|NZ_CP009427|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.667
caacgccggcaccggcggcgccatcggctccgg CRISPR spacer
gctcgccgggaccgccggcgccatcggtcagat Protospacer
****** **** ************.. .
1699. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
1700. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
1701. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
1702. spacer 6.3|1207643|34|NZ_CP009427|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*