Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009451 Cedecea neteri strain SSMD04 chromosome, complete genome 3 crisprs DEDDh,cas3,DinG,csa3 0 2 7 0

Results visualization

1. NZ_CP009451
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009451_1 128501-128581 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009451_2 2914540-2914624 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009451_3 3184485-3184556 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 2487-2519 5 0.848
NZ_CP009451_1 1.1|128528|27|NZ_CP009451|CRISPRCasFinder 128528-128554 27 MF893271 Lysinibacillus phage vB_LspM-01, complete genome 40151-40177 6 0.778
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 422249-422281 6 0.818
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 167188-167220 6 0.818
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 75891-75923 6 0.818
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 9764-9796 7 0.788
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 262923-262955 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 31009-31041 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 336754-336786 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_KT935446 Klebsiella pneumoniae strain Kp2964 plasmid 2964TF, complete sequence 111737-111769 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP035215 Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence 173219-173251 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 192430-192462 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 44014-44046 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 24661-24693 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 30639-30671 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP019841 Enterobacter roggenkampii strain R11 plasmid pASM2, complete sequence 37788-37820 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 137727-137759 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 6340-6372 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP010365 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-70.092kb, complete sequence 39753-39785 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 236165-236197 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 143062-143094 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP017452 Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence 83072-83104 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 89365-89397 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 234934-234966 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 66847-66879 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 24056-24088 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 30756-30788 8 0.758
NZ_CP009451_2 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder 2914566-2914598 33 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 31870-31902 8 0.758

1. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 5, identity: 0.848

agaggggcggggtgagggcatcaggcaaccccg-	CRISPR spacer
agagggtcggggtgagggcatca-gcacgcacgt	Protospacer
****** **************** ***  * ** 

2. spacer 1.1|128528|27|NZ_CP009451|CRISPRCasFinder matches to MF893271 (Lysinibacillus phage vB_LspM-01, complete genome) position: , mismatch: 6, identity: 0.778

aaaagctatgggaaacattgtttatca	CRISPR spacer
gcataatatgggaaacattgtttatta	Protospacer
. * . *******************.*

3. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 6, identity: 0.818

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggccggggtgagggcatcaggcattagcc	Protospacer
****** ******************** .  * 

4. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 6, identity: 0.818

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggtcggggtgagggcatcagaccgcacct	Protospacer
****** *****************.* .* ** 

5. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.818

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggccggggtgagggcatcaagccgcaccc	Protospacer
****** ****************.** .* ** 

6. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 7, identity: 0.788

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggccggggtgagggcatcagaccgcacgt	Protospacer
****** *****************.* .* *  

7. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggccggggtgagggcatcagcgcgcacgt	Protospacer
****** *****************   .* *  

8. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

9. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

10. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_KT935446 (Klebsiella pneumoniae strain Kp2964 plasmid 2964TF, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

11. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP035215 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-A, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

12. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

13. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

14. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

15. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

16. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP019841 (Enterobacter roggenkampii strain R11 plasmid pASM2, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

17. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

18. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

19. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP010365 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-70.092kb, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

20. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

21. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

22. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP017452 (Klebsiella sp. LTGPAF-6F plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

23. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

24. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

25. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

26. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

27. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

28. spacer 2.1|2914566|33|NZ_CP009451|CRISPRCasFinder matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 8, identity: 0.758

agaggggcggggtgagggcatcaggcaaccccg	CRISPR spacer
agagggttggggtgagggcatcagcccgcgact	Protospacer
****** .**************** * .*  * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 358490 : 422898 78 Enterobacteria_phage(27.78%) head,plate,capsid,portal,terminase,holin,tail,transposase NA
DBSCAN-SWA_2 447212 : 514664 55 Bacillus_phage(20.0%) protease,plate,transposase NA
DBSCAN-SWA_3 1144972 : 1154358 8 Bacillus_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_4 1622720 : 1632775 7 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_5 3690050 : 3709127 29 uncultured_Caudovirales_phage(30.43%) tail,lysis NA
DBSCAN-SWA_6 4349081 : 4360943 12 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_7 4598120 : 4638990 60 Salmonella_phage(34.15%) integrase,plate,terminase,holin,tail attL 4596267:4596283|attR 4632561:4632577
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage