Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009447 Mycobacterium abscessus subsp. bolletii strain MM1513, complete genome 5 crisprs csa3,cas3,WYL,cas4,DEDDh,DinG 0 1 3 0

Results visualization

1. NZ_CP009447
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009447_1 266359-266453 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009447_2 728825-728955 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009447_3 1322158-1322246 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009447_4 3666245-3666332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009447_5 4464142-4464243 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009447_4 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder 3666276-3666301 26 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 418376-418401 5 0.808
NZ_CP009447_4 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder 3666276-3666301 26 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 678153-678178 5 0.808
NZ_CP009447_4 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder 3666276-3666301 26 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 54049-54074 6 0.769
NZ_CP009447_4 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder 3666276-3666301 26 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 143457-143482 6 0.769

1. spacer 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808

tggccccaaccaccctggccggggtt	CRISPR spacer
ccgccgcgaccaccctggccggggtc	Protospacer
. *** *.*****************.

2. spacer 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.808

tggccccaaccaccctggccggggtt	CRISPR spacer
ccgccgcgaccaccctggccggggtc	Protospacer
. *** *.*****************.

3. spacer 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 6, identity: 0.769

tggccccaaccaccctggccggggtt	CRISPR spacer
gtgccccaaccaccctcgccgggcaa	Protospacer
  ************** ******   

4. spacer 4.1|3666276|26|NZ_CP009447|CRISPRCasFinder matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 6, identity: 0.769

tggccccaaccaccctggccggggtt	CRISPR spacer
gtgccccaaccaccctcgccgggcaa	Protospacer
  ************** ******   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 62208 : 75334 11 Mycobacterium_phage(28.57%) NA NA
DBSCAN-SWA_2 761134 : 770633 9 Shahe_endorna-like_virus(25.0%) NA NA
DBSCAN-SWA_3 1948677 : 1957236 7 uncultured_Mediterranean_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage