Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009573 Sphingomonas taxi strain ATCC 55669 plasmid STP2, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP009572 Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009571 Sphingomonas taxi strain ATCC 55669 chromosome, complete genome 1 crisprs DinG,DEDDh,WYL,csa3 0 1 2 0

Results visualization

1. NZ_CP009571
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009571_1 3402823-3402896 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009571_1 1.1|3402846|28|NZ_CP009571|CRISPRCasFinder 3402846-3402873 28 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1161316-1161343 7 0.75

1. spacer 1.1|3402846|28|NZ_CP009571|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.75

gccgcagcgccaggcacgtcagtgggag	CRISPR spacer
accgcagcgccagccacgtcagcgttgc	Protospacer
.************ ********.*  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 396817 : 404331 10 Pelagibacter_phage(16.67%) NA NA
DBSCAN-SWA_2 3442177 : 3471510 33 Rhodobacter_phage(15.38%) portal,capsid,head,integrase,tail,protease attL 3445716:3445736|attR 3484933:3484953
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage