Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP004378 Burkholderia pseudomallei NAU35A-3 chromosome 2, complete sequence 3 crisprs cas3,csa3,DinG 2 0 186 0
NZ_CP004377 Burkholderia pseudomallei NAU35A-3 chromosome 1, complete sequence 2 crisprs DEDDh,WYL,csa3 0 6 7 0

Results visualization

1. NZ_CP004378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004378_1 377128-377229 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004378_2 810828-810920 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004378_3 2371156-2371461 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3335997-3336011 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3336005-3336019 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767695-3767709 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767703-3767717 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767711-3767725 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767719-3767733 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767727-3767741 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767735-3767749 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767743-3767757 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 3767751-3767765 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 1562373-1562387 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004377.1 1562381-1562395 0 1.0
NZ_CP004378_3 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder 2371342-2371356 15 NZ_CP004378.1 2178633-2178647 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3335997-3336011 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3336005-3336019 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767695-3767709 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767703-3767717 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767711-3767725 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767719-3767733 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767727-3767741 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767735-3767749 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767743-3767757 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 3767751-3767765 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 1562373-1562387 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004377.1 1562381-1562395 0 1.0
NZ_CP004378_3 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder 2371382-2371396 15 NZ_CP004378.1 2178633-2178647 0 1.0

1. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3335997-3336011, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

2. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3336005-3336019, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

3. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767695-3767709, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

4. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767703-3767717, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

5. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767711-3767725, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

6. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767719-3767733, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

7. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767727-3767741, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

8. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767735-3767749, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

9. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767743-3767757, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

10. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767751-3767765, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

11. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 1562373-1562387, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

12. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 1562381-1562395, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

13. spacer 3.5|2371342|15|NZ_CP004378|CRISPRCasFinder matches to position: 2178633-2178647, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

14. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3335997-3336011, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

15. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3336005-3336019, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

16. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767695-3767709, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

17. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767703-3767717, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

18. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767711-3767725, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

19. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767719-3767733, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

20. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767727-3767741, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

21. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767735-3767749, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

22. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767743-3767757, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

23. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 3767751-3767765, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

24. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 1562373-1562387, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

25. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 1562381-1562395, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

26. spacer 3.6|2371382|15|NZ_CP004378|CRISPRCasFinder matches to position: 2178633-2178647, mismatch: 0, identity: 1.0

ggttcggcggttcgg	CRISPR spacer
ggttcggcggttcgg	Protospacer
***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 25541 20 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_2 30926 : 40253 10 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 51427 : 52594 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 71364 : 72075 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_5 92351 : 97872 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_6 105186 : 109568 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_7 113513 : 188037 52 Ectocarpus_siliculosus_virus(12.5%) plate,holin,transposase NA
DBSCAN-SWA_8 196693 : 207316 6 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_9 231001 : 231712 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_10 264914 : 267158 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_11 276464 : 279997 5 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_12 284073 : 285961 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_13 292286 : 295441 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_14 309140 : 315483 3 Acanthamoeba_polyphaga_mimivirus(50.0%) NA NA
DBSCAN-SWA_15 321645 : 324264 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_16 348533 : 351455 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_17 362172 : 363978 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_18 373237 : 375079 1 Loktanella_phage(100.0%) NA NA
DBSCAN-SWA_19 391702 : 393103 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_20 403076 : 409353 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_21 413353 : 415108 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_22 422913 : 426404 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_23 431074 : 431932 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_24 447391 : 447736 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_25 454912 : 464561 6 Sinorhizobium_phage(66.67%) NA NA
DBSCAN-SWA_26 495521 : 496583 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_27 529553 : 531005 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_28 541461 : 542964 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_29 547852 : 549972 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_30 569037 : 569961 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_31 573166 : 574288 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_32 590442 : 620089 19 Acanthocystis_turfacea_Chlorella_virus(25.0%) plate,transposase NA
DBSCAN-SWA_33 626554 : 626710 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_34 632830 : 634075 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_35 642071 : 644673 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_36 647839 : 655910 3 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_37 670851 : 674828 3 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_38 685883 : 687545 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_39 694466 : 695327 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_40 702774 : 703983 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_41 708512 : 712767 4 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_42 722329 : 724147 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_43 730752 : 732369 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_44 742062 : 743526 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_45 749452 : 750961 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_46 782388 : 786220 4 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_47 793414 : 797974 6 Musca_hytrovirus(50.0%) NA NA
DBSCAN-SWA_48 814403 : 818682 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_49 822173 : 825419 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_50 831271 : 831976 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_51 836388 : 838077 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_52 842811 : 843690 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_53 850099 : 851479 1 Clostridium_botulinum_C_phage(100.0%) NA NA
DBSCAN-SWA_54 877367 : 878501 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_55 888657 : 890238 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_56 896413 : 898090 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_57 901393 : 907713 4 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_58 914594 : 918179 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_59 925200 : 927029 3 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_60 933585 : 935047 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_61 943854 : 944889 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_62 949291 : 954093 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_63 968802 : 974093 5 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_64 978638 : 980572 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_65 999687 : 1000389 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_66 1010486 : 1011715 3 Burkholderia_phage(100.0%) portal,tail,integrase attL 1001102:1001121|attR 1017939:1017958
DBSCAN-SWA_67 1016352 : 1019875 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_68 1032229 : 1039993 7 Moraxella_phage(25.0%) tRNA NA
DBSCAN-SWA_69 1043617 : 1048153 3 Cronobacter_phage(50.0%) NA NA
DBSCAN-SWA_70 1052758 : 1056205 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_71 1067199 : 1068300 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_72 1082072 : 1083737 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_73 1121331 : 1122180 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_74 1126814 : 1133612 6 Mollivirus(25.0%) NA NA
DBSCAN-SWA_75 1142250 : 1144810 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_76 1157386 : 1159297 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_77 1170029 : 1171955 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_78 1183541 : 1184540 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_79 1199751 : 1216129 4 Ostreococcus_tauri_virus(33.33%) NA NA
DBSCAN-SWA_80 1220413 : 1247643 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_81 1287356 : 1289159 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_82 1319493 : 1320276 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_83 1325507 : 1327115 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_84 1332980 : 1334570 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_85 1339621 : 1340941 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_86 1375094 : 1375658 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_87 1382898 : 1440615 45 Acinetobacter_phage(14.29%) plate,transposase NA
DBSCAN-SWA_88 1480430 : 1482038 1 Pike_perch_iridovirus(100.0%) NA NA
DBSCAN-SWA_89 1494453 : 1496250 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_90 1517401 : 1519901 3 Ostreococcus_tauri_virus(50.0%) NA NA
DBSCAN-SWA_91 1523990 : 1526885 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_92 1548594 : 1550361 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_93 1559257 : 1560807 2 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_94 1568016 : 1569357 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_95 1587240 : 1593685 8 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_96 1601795 : 1603493 1 Catovirus(100.0%) holin NA
DBSCAN-SWA_97 1616373 : 1623741 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_98 1638104 : 1639529 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_99 1650962 : 1653857 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_100 1659457 : 1665880 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_101 1676358 : 1680688 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_102 1696459 : 1698583 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_103 1710123 : 1710714 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_104 1719597 : 1737128 4 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_105 1763616 : 1764249 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_106 1779412 : 1780414 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_107 1783536 : 1784730 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_108 1791737 : 1792520 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_109 1806370 : 1807924 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_110 1817572 : 1819813 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_111 1823459 : 1824143 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_112 1827532 : 1828828 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_113 1833671 : 1843163 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_114 1863209 : 1864727 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_115 1870060 : 1876947 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_116 1881539 : 1889045 2 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_117 1908898 : 1910428 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_118 1942345 : 1952745 8 Indivirus(25.0%) NA NA
DBSCAN-SWA_119 1957938 : 1959939 1 Bathycoccus_sp._RCC1105_virus(100.0%) protease NA
DBSCAN-SWA_120 1966840 : 1967317 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_121 1974748 : 1984456 6 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_122 1992139 : 1993117 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_123 2001721 : 2003802 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_124 2011590 : 2013417 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_125 2022793 : 2023315 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_126 2036282 : 2037725 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_127 2106540 : 2110125 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_128 2116826 : 2117594 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_129 2129703 : 2132490 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_130 2155509 : 2157495 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_131 2165197 : 2171775 7 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_132 2187076 : 2188639 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_133 2191796 : 2192540 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_134 2200640 : 2205029 4 Burkholderia_virus(100.0%) integrase attL 2197292:2197307|attR 2210446:2210461
DBSCAN-SWA_135 2226507 : 2227305 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_136 2235016 : 2242532 9 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_137 2255619 : 2256969 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_138 2312160 : 2314365 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_139 2338638 : 2340705 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_140 2357750 : 2358527 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_141 2364290 : 2365847 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_142 2391768 : 2392566 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_143 2406304 : 2407951 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_144 2428834 : 2437143 4 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_145 2440197 : 2441706 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_146 2471834 : 2472902 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_147 2485422 : 2487474 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_148 2498535 : 2500506 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_149 2510879 : 2511098 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_150 2539571 : 2540951 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_151 2544509 : 2544986 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_152 2551876 : 2557214 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_153 2562826 : 2564788 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_154 2568573 : 2572883 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_155 2592122 : 2594285 2 Serratia_phage(50.0%) NA NA
DBSCAN-SWA_156 2605224 : 2620091 5 Indivirus(25.0%) NA NA
DBSCAN-SWA_157 2628235 : 2629710 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_158 2642095 : 2709820 50 Aeromonas_phage(25.0%) plate,holin NA
DBSCAN-SWA_159 2744770 : 2757580 7 Euproctis_pseudoconspersa_nucleopolyhedrovirus(25.0%) NA NA
DBSCAN-SWA_160 2764303 : 2769912 4 uncultured_virus(66.67%) NA NA
DBSCAN-SWA_161 2779808 : 2781940 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_162 2787602 : 2789450 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_163 2795631 : 2797554 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_164 2805822 : 2806644 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_165 2831671 : 2835903 3 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_166 2845549 : 2847262 1 Micromonas_pusilla_virus(100.0%) NA NA
DBSCAN-SWA_167 2866508 : 2939538 87 Burkholderia_virus(92.96%) tail,lysis,transposase,capsid,integrase,head,portal,holin,terminase attL 2869702:2869720|attR 2878624:2878642
DBSCAN-SWA_168 2944127 : 2948140 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_169 2975720 : 2976272 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_170 2980811 : 2981909 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_171 3017376 : 3018591 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_172 3053272 : 3055132 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_173 3064869 : 3070250 3 Leptospira_phage(50.0%) NA NA
DBSCAN-SWA_174 3081560 : 3083258 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_175 3091472 : 3093017 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_176 3102817 : 3104932 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_177 3116594 : 3118112 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_178 3123642 : 3124686 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_179 3133670 : 3134489 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_180 3144719 : 3145526 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_181 3160951 : 3164137 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_182 3168607 : 3169303 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_183 3173573 : 3175187 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_184 3188827 : 3190456 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_185 3208765 : 3210061 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_186 3230012 : 3232952 1 Vibrio_phage(100.0%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP004377
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004377_1 2371629-2371708 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004377_2 2530342-2530702 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP004377_2 2.1|2530360|28|NZ_CP004377|CRT 2530360-2530387 28 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 306425-306452 6 0.786
NZ_CP004377_2 2.1|2530360|28|NZ_CP004377|CRT 2530360-2530387 28 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 73536-73563 6 0.786
NZ_CP004377_2 2.2|2530406|29|NZ_CP004377|CRT 2530406-2530434 29 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 119428-119456 6 0.793
NZ_CP004377_2 2.3|2530453|28|NZ_CP004377|CRT 2530453-2530480 28 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 79157-79184 6 0.786
NZ_CP004377_2 2.3|2530453|28|NZ_CP004377|CRT 2530453-2530480 28 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 89072-89099 6 0.786
NZ_CP004377_2 2.3|2530453|28|NZ_CP004377|CRT 2530453-2530480 28 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 216447-216474 6 0.786
NZ_CP004377_2 2.3|2530453|28|NZ_CP004377|CRT 2530453-2530480 28 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 459201-459228 6 0.786
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279887 Mycobacterium phage Timmi, complete genome 40471-40499 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH651175 Mycobacterium phage Gophee, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 GQ303264 Mycobacterium phage Puhltonio, complete genome 40765-40793 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 GU247134 Mycobacterium phage Scoot17C, complete genome 40898-40926 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX683293 Mycobacterium phage Daffy, complete genome 40480-40508 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279888 Mycobacterium phage TomBombadil, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JF957056 Mycobacterium phage Thora, complete genome 40771-40799 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT316463 Mycobacterium phage Slatt, complete genome 40775-40803 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX576645 Mycobacterium phage Derpp, complete genome 40325-40353 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH651184 Mycobacterium phage Phareon, complete genome 40464-40492 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN006063 Mycobacterium phage Serendipity, complete genome 40779-40807 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH779500 Mycobacterium phage Crownjwl, complete genome 40543-40571 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH230875 Mycobacterium phage CheetO, complete genome 40766-40794 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG962365 Mycobacterium phage DoesntMatter, complete genome 40752-40780 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279882 Mycobacterium phage Sophia, complete genome 40470-40498 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX670813 Mycobacterium phage MitKao, complete genome 40468-40496 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH576970 Mycobacterium phage DonSanchon, complete genome 40462-40490 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279866 Mycobacterium phage MRabcd, complete genome 40461-40489 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH513973 Mycobacterium phage Kwksand96, complete genome 40330-40358 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN945899 Mycobacterium phage Skippy, complete genome 40749-40777 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279908 Mycobacterium phage Roliet, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_023727 Mycobacterium phage Vista, complete genome 40769-40797 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT897909 Mycobacterium phage Maru, complete genome 40413-40441 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH727555 Mycobacterium phage Mulan, complete genome 40624-40652 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_027985 Mycobacterium phage UncleHowie, complete genome 40468-40496 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN698990 Mycobacterium phage IsaacEli, complete genome 40907-40935 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KY965066 Mycobacterium phage BlackStallion, complete genome 40902-40930 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN703415 Mycobacterium phage Mcshane, complete genome 40462-40490 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX592589 Mycobacterium phage Iridoclysis, complete genome 40748-40776 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH051251 Mycobacterium phage DuchessDung, complete genome 39751-39779 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX576646 Mycobacterium phage TyrionL, complete genome 40325-40353 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279871 Mycobacterium phage Plmatters, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279883 Mycobacterium phage Struggle, complete genome 40317-40345 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN096366 Mycobacterium phage AbsoluteMadLad, complete genome 40771-40799 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH371107 Mycobacterium phage Doddsville, complete genome 40479-40507 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_028942 Mycobacterium phage Phipps, complete sequence 40744-40772 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KJ567044 Mycobacterium phage EmpTee, complete genome 40765-40793 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279881 Mycobacterium phage Solosis, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG944223 Mycobacterium phage Trypo, complete genome 40900-40928 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT897902 Mycobacterium phage Boehler, complete genome 40772-40800 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279855 Mycobacterium phage Haleema, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JX649096 Mycobacterium phage Serpentine, complete genome 40766-40794 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK494104 Mycobacterium phage HenryJackson, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG944225 Mycobacterium phage Xavier, complete genome 40473-40501 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JX649099 Mycobacterium phage Gyarad, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH450116 Mycobacterium phage Buckeye, complete genome 40786-40814 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN638753 Mycobacterium phage Morgushi, complete genome 40469-40497 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG757158 Mycobacterium phage HighStump, complete genome 40603-40631 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112539 Mycobacterium phage Dione, complete genome 40459-40487 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279873 Mycobacterium phage QueenBeane, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF668276 Mycobacterium phage Lulumae, complete genome 40455-40483 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT897903 Mycobacterium phage DirtJuice, complete genome 40749-40777 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH513980 Mycobacterium phage Roy17, complete genome 40455-40483 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT316460 Mycobacterium phage Kimbrough, complete genome 40480-40508 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JF937097 Mycobacterium phage Hertubise, complete genome 40776-40804 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH230874 Mycobacterium phage Banjo, complete genome 40448-40476 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH651186 Mycobacterium phage Podrick, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG962362 Mycobacterium phage AltPhacts, complete genome 40744-40772 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JF704103 Mycobacterium phage Vortex, complete sequence 40466-40494 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 FJ174694 Mycobacterium phage Chah, complete genome 40916-40944 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH051264 Mycobacterium phage Cobra, complete genome 40767-40795 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112536 Mycobacterium phage Cannibal, complete genome 40738-40766 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX578071 Mycobacterium phage Mana, complete genome 40470-40498 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF919539 Mycobacterium phage Virapocalypse, complete genome 40759-40787 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KC661274 Mycobacterium phage SDcharge11, complete genome 40742-40770 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KJ194579 Mycobacterium phage Swish, complete genome 40890-40918 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH371114 Mycobacterium phage Childish, complete genome 40486-40514 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279852 Mycobacterium phage Fringe, complete genome 40886-40914 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KY385382 Mycobacterium phage ImtiyazSitla, complete genome 40451-40479 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN699010 Mycobacterium phage TallGrassMM, complete genome 40385-40413 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG757159 Mycobacterium phage JangoPhett, complete genome 40759-40787 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279891 Mycobacterium phage Wallhey, complete genome 40329-40357 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF919503 Mycobacterium phage Dingo, complete genome 40750-40778 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KY676783 Mycobacterium phage Chorkpop, complete genome 40482-40510 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112527 Mycobacterium phage Altwerkus, complete genome 40450-40478 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JX649100 Mycobacterium phage Alex, complete genome 40792-40820 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_028691 Mycobacterium phage Apizium, complete genome 40650-40678 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH371125 Mycobacterium phage Morty, complete genome 40907-40935 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JF937109 Mycobacterium phage Yoshand, complete genome 40903-40931 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279878 Mycobacterium phage Samaymay, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH399786 Mycobacterium phage PhrodoBaggins, complete genome 40892-40920 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112551 Mycobacterium phage Riggan, complete genome 40751-40779 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN945903 Mycobacterium phage Jiminy, complete genome 40319-40347 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KM363597 Mycobacteriophage Zonia, complete genome 40780-40808 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KF713485 Mycobacterium phage Suffolk, complete genome 40766-40794 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG770212 Mycobacterium phage Haimas, complete genome 40762-40790 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279861 Mycobacterium phage Legolas, complete genome 40500-40528 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279843 Mycobacterium phage CamL, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279846 Mycobacterium phage Cosmolli16, complete genome 40474-40502 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KM408320 Mycobacterium phage Lasso, complete genome 40730-40758 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KR029086 Mycobacterium phage PDRPv, complete genome 40479-40507 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KY385380 Mycobacterium phage Ashraf, complete genome 40451-40479 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH825705 Mycobacterium phage Mesh1, complete genome 40777-40805 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT952849 Mycobacterium phage Windsor, complete genome 40465-40493 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH576954 Mycobacterium phage HSavage, complete genome 40768-40796 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112555 Mycobacterium phage Zelda, complete genome 40810-40838 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_028803 Mycobacterium phage OSmaximus, complete genome 40940-40968 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279904 Mycobacterium phage RedMaple, complete genome 40906-40934 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KR029087 Mycobacterium phage PDRPxv, complete genome 40540-40568 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN699009 Mycobacterium phage ThreeOh3D2, complete genome 40904-40932 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_005259 Mycobacterium phage PG1, complete genome 40909-40937 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112552 Mycobacterium phage Spartan300, complete genome 40761-40789 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX702319 Mycobacterium phage Pinkman, complete genome 40323-40351 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF919523 Mycobacterium phage Mikota, complete genome 40748-40776 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KU867907 Mycobacterium phage Potter, complete genome 40479-40507 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH590588 Mycobacterium phage Vaticameos, complete genome 38450-38478 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279885 Mycobacterium phage Surely, complete genome 40772-40800 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279870 Mycobacterium phage Omniscient, complete genome 40775-40803 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN638752 Mycobacterium phage Murdoc, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG962375 Mycobacterium phage ProfessorX, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG925348 Mycobacterium phage Megatron, complete genome 40898-40926 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH077582 Mycobacterium phage Olive, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF155947 Mycobacterium phage LemonSlice, complete genome 40467-40495 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KP027209 Mycobacterium phage Sigman, complete genome 40889-40917 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH450122 Mycobacterium phage KingTut, complete genome 36143-36171 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279859 Mycobacterium phage Kwadwo, complete genome 40455-40483 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112546 Mycobacterium phage LuckyMarjie, complete genome 40470-40498 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX620786 Mycobacterium phage Lego3393, complete genome 40910-40938 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112544 Mycobacterium phage Keitherie, complete genome 40819-40847 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KP027197 Mycobacterium phage FluffyNinja, complete genome 40903-40931 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH651177 Mycobacterium phage KlimbOn, complete genome 40757-40785 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279877 Mycobacterium phage Roscoe, complete genome 41001-41029 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN698989 Mycobacterium phage JacAttac, complete genome 40889-40917 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH479918 Mycobacterium phage Labeouficaum, complete genome 40325-40353 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112553 Mycobacterium Phage Squiggle, complete genome 40485-40513 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_028907 Mycobacterium phage Kikipoo, complete genome 40907-40935 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279850 Mycobacterium phage Durga, complete genome 40917-40945 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279897 Mycobacterium phage Bishoperium, complete genome 40463-40491 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN585965 Mycobacterium phage Duggie, complete genome 40481-40509 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT310868 Mycobacterium phage Telesworld, complete genome 40464-40492 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279865 Mycobacterium phage Mecca, complete genome 40468-40496 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KC576784 Mycobacterium phage ShiVal, complete genome 40765-40793 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH479916 Mycobacterium phage GeneCoco, complete genome 40773-40801 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN444868 Mycobacterium phage Prickles, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KY385383 Mycobacterium phage Maskar, complete genome 40451-40479 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH371117 Mycobacterium phage Kahve, complete genome 40473-40501 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH399773 Mycobacterium phage Craff, complete genome 40902-40930 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 GU247133 Mycobacterium phage Fang, complete genome 40910-40938 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_008197 Mycobacterium phage Orion, complete genome 40896-40924 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH479921 Mycobacterium phage Placalicious, complete genome 40461-40489 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT897901 Mycobacterium phage Adriana, complete genome 40892-40920 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN369744 Mycobacterium phage Beaglebox, complete genome 40469-40497 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF919530 Mycobacterium phage Sheila, complete genome 40804-40832 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG925356 Mycobacterium phage OliverWalter, complete genome 40778-40806 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JX649098 Mycobacterium phage Nacho, complete genome 40901-40929 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT889369 Mycobacterium phage Inchworm, complete genome 40889-40917 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KP027208 Mycobacterium phage Pipsqueak, complete genome 40768-40796 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF919519 Mycobacterium phage Longacauda, complete genome 40463-40491 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JF704109 Mycobacterium phage Oosterbaan, complete sequence 40763-40791 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX369585 Mycobacterium phage PhatCats2014, complete genome 40913-40941 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK310139 Mycobacterium phage Emiris, complete genome 40885-40913 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KJ194580 Mycobacterium phage Badfish, complete genome 40917-40945 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KX576647 Mycobacterium phage CharlieGBrown, complete genome 40336-40364 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN369738 Mycobacterium phage Hocus, complete genome 40465-40493 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279889 Mycobacterium phage Valjean, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH399775 Mycobacterium phage Gareth, complete genome 40458-40486 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279894 Mycobacterium phage YouGoGlencoco, complete genome 40763-40791 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279895 Mycobacterium phage Zaider, complete genome 40993-41021 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MN585967 Mycobacterium phage Kloppinator, complete genome 41182-41210 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK279858 Mycobacterium phage JakeO, complete genome 40484-40512 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_028681 Mycobacterium phage Pops, complete genome 40779-40807 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH744417 Mycobacterium phage Grand2040, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JX649097 Mycobacterium phage Piglet, complete genome 40874-40902 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MG925350 Mycobacterium phage Mosaic, complete genome 40462-40490 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH479914 Mycobacterium phage FugateOSU, complete genome 40464-40492 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH825702 Mycobacterium phage Hamish, complete genome 40754-40782 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JF704091 Mycobacterium phage ABU, complete sequence 40894-40922 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF919528 Mycobacterium phage Phunky, complete genome 40761-40789 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_028690 Mycobacterium phage Eremos, complete genome 40758-40786 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KJ538723 Mycobacterium phage KingVeVeVe, complete genome 40751-40779 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JN192463 Mycobacterium phage Oline, complete genome 40329-40357 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NC_021310 Mycobacterium phage Newman, complete genome 40760-40788 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MK112542 Mycobacterium phage Jillium, complete genome 40478-40506 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MT310867 Mycobacterium phage Chaelin, complete genome 40461-40489 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KJ194583 Mycobacterium phage Numberten, complete genome 40767-40795 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH590594 Mycobacterium phage PinheadLarry, complete genome 40474-40502 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 KJ174157 Mycobacterium phage Soto, complete genome 40776-40804 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH399780 Mycobacterium phage Mutante, complete genome 40474-40502 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 JF704099 Mycobacterium phage KLucky39, complete sequence 40763-40791 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MH779516 Mycobacterium phage Waterdiva, complete genome 40761-40789 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 MF919507 Mycobacterium phage Horchata, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.4|2530499|29|NZ_CP004377|CRT 2530499-2530527 29 NZ_CP045374 Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence 161362-161390 6 0.793
NZ_CP004377_2 2.5|2530546|28|NZ_CP004377|CRT 2530546-2530573 28 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 79157-79184 6 0.786
NZ_CP004377_2 2.5|2530546|28|NZ_CP004377|CRT 2530546-2530573 28 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 89072-89099 6 0.786
NZ_CP004377_2 2.5|2530546|28|NZ_CP004377|CRT 2530546-2530573 28 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 216447-216474 6 0.786
NZ_CP004377_2 2.5|2530546|28|NZ_CP004377|CRT 2530546-2530573 28 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 459201-459228 6 0.786
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279887 Mycobacterium phage Timmi, complete genome 40471-40499 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH651175 Mycobacterium phage Gophee, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 GQ303264 Mycobacterium phage Puhltonio, complete genome 40765-40793 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 GU247134 Mycobacterium phage Scoot17C, complete genome 40898-40926 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX683293 Mycobacterium phage Daffy, complete genome 40480-40508 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279888 Mycobacterium phage TomBombadil, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JF957056 Mycobacterium phage Thora, complete genome 40771-40799 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT316463 Mycobacterium phage Slatt, complete genome 40775-40803 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX576645 Mycobacterium phage Derpp, complete genome 40325-40353 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH651184 Mycobacterium phage Phareon, complete genome 40464-40492 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN006063 Mycobacterium phage Serendipity, complete genome 40779-40807 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH779500 Mycobacterium phage Crownjwl, complete genome 40543-40571 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH230875 Mycobacterium phage CheetO, complete genome 40766-40794 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG962365 Mycobacterium phage DoesntMatter, complete genome 40752-40780 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279882 Mycobacterium phage Sophia, complete genome 40470-40498 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX670813 Mycobacterium phage MitKao, complete genome 40468-40496 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH576970 Mycobacterium phage DonSanchon, complete genome 40462-40490 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279866 Mycobacterium phage MRabcd, complete genome 40461-40489 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH513973 Mycobacterium phage Kwksand96, complete genome 40330-40358 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN945899 Mycobacterium phage Skippy, complete genome 40749-40777 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279908 Mycobacterium phage Roliet, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_023727 Mycobacterium phage Vista, complete genome 40769-40797 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT897909 Mycobacterium phage Maru, complete genome 40413-40441 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH727555 Mycobacterium phage Mulan, complete genome 40624-40652 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_027985 Mycobacterium phage UncleHowie, complete genome 40468-40496 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN698990 Mycobacterium phage IsaacEli, complete genome 40907-40935 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KY965066 Mycobacterium phage BlackStallion, complete genome 40902-40930 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN703415 Mycobacterium phage Mcshane, complete genome 40462-40490 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX592589 Mycobacterium phage Iridoclysis, complete genome 40748-40776 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH051251 Mycobacterium phage DuchessDung, complete genome 39751-39779 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX576646 Mycobacterium phage TyrionL, complete genome 40325-40353 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279871 Mycobacterium phage Plmatters, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279883 Mycobacterium phage Struggle, complete genome 40317-40345 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN096366 Mycobacterium phage AbsoluteMadLad, complete genome 40771-40799 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH371107 Mycobacterium phage Doddsville, complete genome 40479-40507 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_028942 Mycobacterium phage Phipps, complete sequence 40744-40772 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KJ567044 Mycobacterium phage EmpTee, complete genome 40765-40793 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279881 Mycobacterium phage Solosis, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG944223 Mycobacterium phage Trypo, complete genome 40900-40928 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT897902 Mycobacterium phage Boehler, complete genome 40772-40800 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279855 Mycobacterium phage Haleema, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JX649096 Mycobacterium phage Serpentine, complete genome 40766-40794 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK494104 Mycobacterium phage HenryJackson, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG944225 Mycobacterium phage Xavier, complete genome 40473-40501 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JX649099 Mycobacterium phage Gyarad, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH450116 Mycobacterium phage Buckeye, complete genome 40786-40814 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN638753 Mycobacterium phage Morgushi, complete genome 40469-40497 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG757158 Mycobacterium phage HighStump, complete genome 40603-40631 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112539 Mycobacterium phage Dione, complete genome 40459-40487 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279873 Mycobacterium phage QueenBeane, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF668276 Mycobacterium phage Lulumae, complete genome 40455-40483 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT897903 Mycobacterium phage DirtJuice, complete genome 40749-40777 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH513980 Mycobacterium phage Roy17, complete genome 40455-40483 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT316460 Mycobacterium phage Kimbrough, complete genome 40480-40508 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JF937097 Mycobacterium phage Hertubise, complete genome 40776-40804 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH230874 Mycobacterium phage Banjo, complete genome 40448-40476 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH651186 Mycobacterium phage Podrick, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG962362 Mycobacterium phage AltPhacts, complete genome 40744-40772 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JF704103 Mycobacterium phage Vortex, complete sequence 40466-40494 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 FJ174694 Mycobacterium phage Chah, complete genome 40916-40944 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH051264 Mycobacterium phage Cobra, complete genome 40767-40795 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112536 Mycobacterium phage Cannibal, complete genome 40738-40766 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX578071 Mycobacterium phage Mana, complete genome 40470-40498 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF919539 Mycobacterium phage Virapocalypse, complete genome 40759-40787 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KC661274 Mycobacterium phage SDcharge11, complete genome 40742-40770 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KJ194579 Mycobacterium phage Swish, complete genome 40890-40918 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH371114 Mycobacterium phage Childish, complete genome 40486-40514 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279852 Mycobacterium phage Fringe, complete genome 40886-40914 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KY385382 Mycobacterium phage ImtiyazSitla, complete genome 40451-40479 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN699010 Mycobacterium phage TallGrassMM, complete genome 40385-40413 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG757159 Mycobacterium phage JangoPhett, complete genome 40759-40787 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279891 Mycobacterium phage Wallhey, complete genome 40329-40357 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF919503 Mycobacterium phage Dingo, complete genome 40750-40778 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KY676783 Mycobacterium phage Chorkpop, complete genome 40482-40510 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112527 Mycobacterium phage Altwerkus, complete genome 40450-40478 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JX649100 Mycobacterium phage Alex, complete genome 40792-40820 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_028691 Mycobacterium phage Apizium, complete genome 40650-40678 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH371125 Mycobacterium phage Morty, complete genome 40907-40935 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JF937109 Mycobacterium phage Yoshand, complete genome 40903-40931 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279878 Mycobacterium phage Samaymay, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH399786 Mycobacterium phage PhrodoBaggins, complete genome 40892-40920 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112551 Mycobacterium phage Riggan, complete genome 40751-40779 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN945903 Mycobacterium phage Jiminy, complete genome 40319-40347 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KM363597 Mycobacteriophage Zonia, complete genome 40780-40808 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KF713485 Mycobacterium phage Suffolk, complete genome 40766-40794 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG770212 Mycobacterium phage Haimas, complete genome 40762-40790 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279861 Mycobacterium phage Legolas, complete genome 40500-40528 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279843 Mycobacterium phage CamL, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279846 Mycobacterium phage Cosmolli16, complete genome 40474-40502 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KM408320 Mycobacterium phage Lasso, complete genome 40730-40758 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KR029086 Mycobacterium phage PDRPv, complete genome 40479-40507 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KY385380 Mycobacterium phage Ashraf, complete genome 40451-40479 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH825705 Mycobacterium phage Mesh1, complete genome 40777-40805 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT952849 Mycobacterium phage Windsor, complete genome 40465-40493 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH576954 Mycobacterium phage HSavage, complete genome 40768-40796 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112555 Mycobacterium phage Zelda, complete genome 40810-40838 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_028803 Mycobacterium phage OSmaximus, complete genome 40940-40968 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279904 Mycobacterium phage RedMaple, complete genome 40906-40934 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KR029087 Mycobacterium phage PDRPxv, complete genome 40540-40568 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN699009 Mycobacterium phage ThreeOh3D2, complete genome 40904-40932 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_005259 Mycobacterium phage PG1, complete genome 40909-40937 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112552 Mycobacterium phage Spartan300, complete genome 40761-40789 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX702319 Mycobacterium phage Pinkman, complete genome 40323-40351 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF919523 Mycobacterium phage Mikota, complete genome 40748-40776 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KU867907 Mycobacterium phage Potter, complete genome 40479-40507 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH590588 Mycobacterium phage Vaticameos, complete genome 38450-38478 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279885 Mycobacterium phage Surely, complete genome 40772-40800 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279870 Mycobacterium phage Omniscient, complete genome 40775-40803 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN638752 Mycobacterium phage Murdoc, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG962375 Mycobacterium phage ProfessorX, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG925348 Mycobacterium phage Megatron, complete genome 40898-40926 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH077582 Mycobacterium phage Olive, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF155947 Mycobacterium phage LemonSlice, complete genome 40467-40495 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KP027209 Mycobacterium phage Sigman, complete genome 40889-40917 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH450122 Mycobacterium phage KingTut, complete genome 36143-36171 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279859 Mycobacterium phage Kwadwo, complete genome 40455-40483 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112546 Mycobacterium phage LuckyMarjie, complete genome 40470-40498 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX620786 Mycobacterium phage Lego3393, complete genome 40910-40938 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112544 Mycobacterium phage Keitherie, complete genome 40819-40847 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KP027197 Mycobacterium phage FluffyNinja, complete genome 40903-40931 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH651177 Mycobacterium phage KlimbOn, complete genome 40757-40785 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279877 Mycobacterium phage Roscoe, complete genome 41001-41029 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN698989 Mycobacterium phage JacAttac, complete genome 40889-40917 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH479918 Mycobacterium phage Labeouficaum, complete genome 40325-40353 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112553 Mycobacterium Phage Squiggle, complete genome 40485-40513 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_028907 Mycobacterium phage Kikipoo, complete genome 40907-40935 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279850 Mycobacterium phage Durga, complete genome 40917-40945 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279897 Mycobacterium phage Bishoperium, complete genome 40463-40491 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN585965 Mycobacterium phage Duggie, complete genome 40481-40509 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT310868 Mycobacterium phage Telesworld, complete genome 40464-40492 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279865 Mycobacterium phage Mecca, complete genome 40468-40496 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KC576784 Mycobacterium phage ShiVal, complete genome 40765-40793 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH479916 Mycobacterium phage GeneCoco, complete genome 40773-40801 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN444868 Mycobacterium phage Prickles, complete genome 40755-40783 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KY385383 Mycobacterium phage Maskar, complete genome 40451-40479 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH371117 Mycobacterium phage Kahve, complete genome 40473-40501 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH399773 Mycobacterium phage Craff, complete genome 40902-40930 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 GU247133 Mycobacterium phage Fang, complete genome 40910-40938 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_008197 Mycobacterium phage Orion, complete genome 40896-40924 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH479921 Mycobacterium phage Placalicious, complete genome 40461-40489 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT897901 Mycobacterium phage Adriana, complete genome 40892-40920 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN369744 Mycobacterium phage Beaglebox, complete genome 40469-40497 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF919530 Mycobacterium phage Sheila, complete genome 40804-40832 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG925356 Mycobacterium phage OliverWalter, complete genome 40778-40806 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JX649098 Mycobacterium phage Nacho, complete genome 40901-40929 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT889369 Mycobacterium phage Inchworm, complete genome 40889-40917 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KP027208 Mycobacterium phage Pipsqueak, complete genome 40768-40796 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF919519 Mycobacterium phage Longacauda, complete genome 40463-40491 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JF704109 Mycobacterium phage Oosterbaan, complete sequence 40763-40791 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX369585 Mycobacterium phage PhatCats2014, complete genome 40913-40941 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK310139 Mycobacterium phage Emiris, complete genome 40885-40913 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KJ194580 Mycobacterium phage Badfish, complete genome 40917-40945 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KX576647 Mycobacterium phage CharlieGBrown, complete genome 40336-40364 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN369738 Mycobacterium phage Hocus, complete genome 40465-40493 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279889 Mycobacterium phage Valjean, complete genome 40764-40792 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH399775 Mycobacterium phage Gareth, complete genome 40458-40486 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279894 Mycobacterium phage YouGoGlencoco, complete genome 40763-40791 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279895 Mycobacterium phage Zaider, complete genome 40993-41021 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MN585967 Mycobacterium phage Kloppinator, complete genome 41182-41210 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK279858 Mycobacterium phage JakeO, complete genome 40484-40512 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_028681 Mycobacterium phage Pops, complete genome 40779-40807 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH744417 Mycobacterium phage Grand2040, complete genome 40476-40504 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JX649097 Mycobacterium phage Piglet, complete genome 40874-40902 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MG925350 Mycobacterium phage Mosaic, complete genome 40462-40490 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH479914 Mycobacterium phage FugateOSU, complete genome 40464-40492 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH825702 Mycobacterium phage Hamish, complete genome 40754-40782 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JF704091 Mycobacterium phage ABU, complete sequence 40894-40922 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF919528 Mycobacterium phage Phunky, complete genome 40761-40789 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_028690 Mycobacterium phage Eremos, complete genome 40758-40786 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KJ538723 Mycobacterium phage KingVeVeVe, complete genome 40751-40779 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JN192463 Mycobacterium phage Oline, complete genome 40329-40357 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NC_021310 Mycobacterium phage Newman, complete genome 40760-40788 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MK112542 Mycobacterium phage Jillium, complete genome 40478-40506 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MT310867 Mycobacterium phage Chaelin, complete genome 40461-40489 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KJ194583 Mycobacterium phage Numberten, complete genome 40767-40795 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH590594 Mycobacterium phage PinheadLarry, complete genome 40474-40502 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 KJ174157 Mycobacterium phage Soto, complete genome 40776-40804 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH399780 Mycobacterium phage Mutante, complete genome 40474-40502 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 JF704099 Mycobacterium phage KLucky39, complete sequence 40763-40791 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MH779516 Mycobacterium phage Waterdiva, complete genome 40761-40789 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 MF919507 Mycobacterium phage Horchata, complete genome 40756-40784 6 0.793
NZ_CP004377_2 2.6|2530592|29|NZ_CP004377|CRT 2530592-2530620 29 NZ_CP045374 Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence 161362-161390 6 0.793
NZ_CP004377_2 2.1|2530360|28|NZ_CP004377|CRT 2530360-2530387 28 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 216447-216474 7 0.75
NZ_CP004377_2 2.1|2530360|28|NZ_CP004377|CRT 2530360-2530387 28 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 459201-459228 7 0.75
NZ_CP004377_2 2.1|2530360|28|NZ_CP004377|CRT 2530360-2530387 28 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 1003771-1003798 7 0.75
NZ_CP004377_2 2.1|2530360|28|NZ_CP004377|CRT 2530360-2530387 28 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 79157-79184 7 0.75
NZ_CP004377_2 2.1|2530360|28|NZ_CP004377|CRT 2530360-2530387 28 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 89072-89099 7 0.75
NZ_CP004377_2 2.3|2530453|28|NZ_CP004377|CRT 2530453-2530480 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2977319-2977346 8 0.714
NZ_CP004377_2 2.5|2530546|28|NZ_CP004377|CRT 2530546-2530573 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2977319-2977346 8 0.714

1. spacer 2.1|2530360|28|NZ_CP004377|CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.786

ttcggtcgaccgccgcggggccagagta	CRISPR spacer
ggcggtcgaccgcatcggggccagaaca	Protospacer
  ***********  **********..*

2. spacer 2.1|2530360|28|NZ_CP004377|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.786

ttcggtcgaccgccgcggggccagagta	CRISPR spacer
ggcggtcgaccgcatcggggccagaaca	Protospacer
  ***********  **********..*

3. spacer 2.2|2530406|29|NZ_CP004377|CRT matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

tctggccgaccacggcatgggatcggagt	CRISPR spacer
ttcggccgaccgcggcctgggatcgggtt	Protospacer
*..********.**** *********. *

4. spacer 2.3|2530453|28|NZ_CP004377|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

5. spacer 2.3|2530453|28|NZ_CP004377|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

6. spacer 2.3|2530453|28|NZ_CP004377|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

7. spacer 2.3|2530453|28|NZ_CP004377|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

8. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

9. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

10. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

11. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

12. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

13. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

14. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

15. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

16. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

17. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

18. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

19. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH779500 (Mycobacterium phage Crownjwl, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

20. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

21. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

22. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

23. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

24. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

25. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

26. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

27. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

28. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

29. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

30. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

31. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

32. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

33. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

34. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

35. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

36. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

37. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

38. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

39. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

40. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

41. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

42. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

43. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

44. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

45. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

46. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

47. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

48. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

49. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

50. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

51. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

52. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

53. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

54. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

55. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

56. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

57. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

58. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

59. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

60. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

61. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

62. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

63. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

64. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

65. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

66. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

67. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

68. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

69. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

70. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

71. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

72. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

73. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

74. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

75. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

76. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

77. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

78. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

79. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

80. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

81. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

82. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

83. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

84. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgattt	Protospacer
*.******.******* ********.  *

85. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH371125 (Mycobacterium phage Morty, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

86. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

87. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

88. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcgtgggatcgatct	Protospacer
*.******.*******.********.  *

89. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

90. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

91. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

92. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

93. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

94. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

95. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

96. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

97. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

98. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

99. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

100. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

101. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

102. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

103. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

104. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

105. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

106. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

107. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

108. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

109. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

110. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

111. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

112. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

113. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

114. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

115. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

116. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

117. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

118. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG925348 (Mycobacterium phage Megatron, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

119. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

120. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

121. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

122. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

123. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

124. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

125. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

126. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

127. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

128. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

129. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

130. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

131. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

132. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

133. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

134. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

135. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

136. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

137. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

138. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

139. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

140. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

141. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

142. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

143. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

144. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

145. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

146. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

147. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

148. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

149. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

150. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

151. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

152. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

153. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcgtgggatcgatct	Protospacer
*.******.*******.********.  *

154. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

155. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

156. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

157. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

158. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

159. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

160. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

161. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

162. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

163. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

164. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

165. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

166. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

167. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

168. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

169. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

170. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

171. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

172. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

173. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

174. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JF704091 (Mycobacterium phage ABU, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

175. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

176. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

177. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

178. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

179. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

180. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

181. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

182. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

183. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

184. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

185. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

186. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

187. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

188. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

189. spacer 2.4|2530499|29|NZ_CP004377|CRT matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
ggcggccatccacggcatgggagcggcgc	Protospacer
* .***** ************* *** *.

190. spacer 2.5|2530546|28|NZ_CP004377|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

191. spacer 2.5|2530546|28|NZ_CP004377|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

192. spacer 2.5|2530546|28|NZ_CP004377|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

193. spacer 2.5|2530546|28|NZ_CP004377|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 6, identity: 0.786

tccgatcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
.**  *** ***************** .

194. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

195. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

196. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

197. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

198. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

199. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

200. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

201. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

202. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

203. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

204. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

205. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH779500 (Mycobacterium phage Crownjwl, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

206. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

207. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

208. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

209. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

210. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

211. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

212. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

213. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

214. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

215. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

216. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

217. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

218. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

219. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

220. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

221. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

222. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

223. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

224. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

225. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

226. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

227. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

228. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

229. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

230. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

231. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

232. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

233. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

234. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

235. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

236. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

237. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

238. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

239. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

240. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

241. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

242. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

243. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

244. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

245. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

246. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

247. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

248. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

249. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

250. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

251. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

252. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

253. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

254. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

255. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

256. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

257. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

258. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

259. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

260. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

261. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

262. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

263. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

264. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

265. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

266. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

267. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

268. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

269. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

270. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgattt	Protospacer
*.******.******* ********.  *

271. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH371125 (Mycobacterium phage Morty, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

272. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

273. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

274. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcgtgggatcgatct	Protospacer
*.******.*******.********.  *

275. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

276. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

277. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

278. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

279. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

280. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

281. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

282. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

283. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

284. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

285. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

286. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

287. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

288. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

289. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

290. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

291. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

292. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

293. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

294. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

295. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

296. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

297. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

298. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

299. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

300. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

301. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

302. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

303. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

304. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG925348 (Mycobacterium phage Megatron, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

305. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

306. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

307. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

308. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

309. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

310. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

311. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

312. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

313. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

314. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

315. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

316. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

317. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

318. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

319. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

320. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

321. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

322. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

323. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

324. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

325. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

326. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

327. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

328. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

329. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

330. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

331. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

332. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

333. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

334. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

335. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

336. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

337. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

338. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

339. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcgtgggatcgatct	Protospacer
*.******.*******.********.  *

340. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

341. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

342. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

343. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

344. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

345. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

346. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

347. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

348. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

349. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

350. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

351. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

352. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

353. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

354. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

355. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

356. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

357. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

358. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

359. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

360. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JF704091 (Mycobacterium phage ABU, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

361. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

362. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

363. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

364. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

365. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

366. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

367. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

368. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

369. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

370. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

371. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

372. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

373. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

374. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
gttggccagccacggcttgggatcgatct	Protospacer
*.******.******* ********.  *

375. spacer 2.6|2530592|29|NZ_CP004377|CRT matches to NZ_CP045374 (Sulfitobacter sp. THAF37 plasmid pTHAF37_b, complete sequence) position: , mismatch: 6, identity: 0.793

gctggccaaccacggcatgggatcggagt	CRISPR spacer
ggcggccatccacggcatgggagcggcgc	Protospacer
* .***** ************* *** *.

376. spacer 2.1|2530360|28|NZ_CP004377|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

ttcggtcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
..*  *** ***************** .

377. spacer 2.1|2530360|28|NZ_CP004377|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.75

ttcggtcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
..*  *** ***************** .

378. spacer 2.1|2530360|28|NZ_CP004377|CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 7, identity: 0.75

ttcggtcgaccgccgcggggccagagta	CRISPR spacer
cgttgtcgaccgtcgcggtgccagagtt	Protospacer
. . ********.***** ******** 

379. spacer 2.1|2530360|28|NZ_CP004377|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 7, identity: 0.75

ttcggtcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
..*  *** ***************** .

380. spacer 2.1|2530360|28|NZ_CP004377|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.75

ttcggtcgaccgccgcggggccagagta	CRISPR spacer
ccctttcgcccgccgcggggccagaggg	Protospacer
..*  *** ***************** .

381. spacer 2.3|2530453|28|NZ_CP004377|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.714

tccgatcgaccgccgcggggccagagta	CRISPR spacer
gatgatcgaccgcagcggggccagtccg	Protospacer
  .********** **********  ..

382. spacer 2.5|2530546|28|NZ_CP004377|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.714

tccgatcgaccgccgcggggccagagta	CRISPR spacer
gatgatcgaccgcagcggggccagtccg	Protospacer
  .********** **********  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88811 : 97004 13 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_2 873250 : 941481 57 Escherichia_phage(16.67%) tRNA,coat,plate,transposase NA
DBSCAN-SWA_3 1539309 : 1550272 10 Agrobacterium_phage(16.67%) protease NA
DBSCAN-SWA_4 2349739 : 2408255 55 Leptospira_phage(17.65%) transposase,tRNA,portal,protease NA
DBSCAN-SWA_5 2835104 : 2849170 15 Burkholderia_phage(75.0%) plate,protease NA
DBSCAN-SWA_6 3177579 : 3190972 11 Hokovirus(12.5%) transposase NA
DBSCAN-SWA_7 3523337 : 3532197 8 Bacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage