Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP004386 Burkholderia thailandensis MSMB59 chromosome 2, complete sequence 2 crisprs DinG,csa3,cas3 0 1 2 0
NZ_CP004385 Burkholderia thailandensis MSMB59 chromosome 1, complete sequence 2 crisprs WYL,cas3,RT,PrimPol,DEDDh,csa3,DinG,PD-DExK 0 0 11 0

Results visualization

1. NZ_CP004386
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004386_1 612228-612319 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004386_2 1852360-1852594 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP004386_2 2.3|1852503|29|NZ_CP004386|CRT 1852503-1852531 29 NC_031074 Gordonia phage Bantam, complete genome 47669-47697 8 0.724

1. spacer 2.3|1852503|29|NZ_CP004386|CRT matches to NC_031074 (Gordonia phage Bantam, complete genome) position: , mismatch: 8, identity: 0.724

gcatgaccggtgctcaccgatcgcgcttg	CRISPR spacer
aggggaccggtgctcgccgagcgcgctac	Protospacer
. . ***********.**** ******  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1684340 : 1743652 46 Xanthomonas_phage(25.0%) transposase,plate NA
DBSCAN-SWA_2 2437768 : 2508319 53 Vibrio_phage(25.0%) holin,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP004385
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004385_1 414283-414406 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP004385_2 2079843-2079942 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 533549 : 590537 41 Moraxella_phage(17.65%) integrase,transposase,tRNA attL 533986:534013|attR 589565:589592
DBSCAN-SWA_2 827431 : 874743 44 Pseudomonas_phage(20.0%) plate,transposase,protease NA
DBSCAN-SWA_3 1178022 : 1187253 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_4 1431323 : 1440265 10 Staphylococcus_phage(28.57%) transposase NA
DBSCAN-SWA_5 1549527 : 1558175 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_6 1835484 : 1924487 98 uncultured_Caudovirales_phage(23.26%) plate,tRNA,integrase,tail,portal,protease,capsid,terminase,head attL 1864855:1864874|attR 1906123:1906142
DBSCAN-SWA_7 2375302 : 2423306 60 Burkholderia_virus(61.22%) plate,transposase,holin,terminase,portal,protease,tail,capsid,head NA
DBSCAN-SWA_8 2799959 : 2867946 52 uncultured_Caudovirales_phage(33.33%) plate,transposase,tRNA,coat NA
DBSCAN-SWA_9 2959944 : 3015011 77 Burkholderia_phage(56.6%) terminase,integrase,head attL 2959826:2959845|attR 3015163:3015182
DBSCAN-SWA_10 3469029 : 3479911 8 Agrobacterium_phage(16.67%) protease NA
DBSCAN-SWA_11 3570672 : 3647892 87 Burkholderia_virus(54.39%) plate,transposase,integrase,protease,tail,head attL 3634278:3634293|attR 3654072:3654087
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage