Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014334 Fervidobacterium islandicum strain AW-1 chromosome, complete genome 2 crisprs cas14k,csa3,cas3,cas3HD,DEDDh,cas2,cas1,cas4,cas5,cas7,cas8b2,cas6,csx1 0 3 3 0

Results visualization

1. NZ_CP014334
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014334_1 1606807-1609460 Unclear I-A
40 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b2,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014334_2 1622583-1624899 Unclear NA
30 spacers
cas6,cas8b2,cas7,cas5,cas3,cas4,cas1,cas2,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014334_1 1.18|1607948|36|NZ_CP014334|CRISPRCasFinder 1607948-1607983 36 NC_007021 Staphylococcus phage Twort, complete genome 105129-105164 8 0.778
NZ_CP014334_1 1.18|1607948|36|NZ_CP014334|CRISPRCasFinder 1607948-1607983 36 MT151386 Staphylococcus virus Twort, complete genome 16952-16987 8 0.778
NZ_CP014334_1 1.94|1607949|36|NZ_CP014334|PILER-CR 1607949-1607984 36 NC_007021 Staphylococcus phage Twort, complete genome 105129-105164 8 0.778
NZ_CP014334_1 1.94|1607949|36|NZ_CP014334|PILER-CR 1607949-1607984 36 MT151386 Staphylococcus virus Twort, complete genome 16952-16987 8 0.778
NZ_CP014334_1 1.58|1607944|40|NZ_CP014334|CRT 1607944-1607983 40 NC_007021 Staphylococcus phage Twort, complete genome 105125-105164 11 0.725
NZ_CP014334_1 1.58|1607944|40|NZ_CP014334|CRT 1607944-1607983 40 MT151386 Staphylococcus virus Twort, complete genome 16948-16987 11 0.725

1. spacer 1.18|1607948|36|NZ_CP014334|CRISPRCasFinder matches to NC_007021 (Staphylococcus phage Twort, complete genome) position: , mismatch: 8, identity: 0.778

ttaaaac-----aattttttacaccttctggaataacaaaa	CRISPR spacer
-----acttctggattttctacaccttctggaatatcaaaa	Protospacer
     **     .*****.**************** *****

2. spacer 1.18|1607948|36|NZ_CP014334|CRISPRCasFinder matches to MT151386 (Staphylococcus virus Twort, complete genome) position: , mismatch: 8, identity: 0.778

ttaaaac-----aattttttacaccttctggaataacaaaa	CRISPR spacer
-----acttctggattttctacaccttctggaatatcaaaa	Protospacer
     **     .*****.**************** *****

3. spacer 1.94|1607949|36|NZ_CP014334|PILER-CR matches to NC_007021 (Staphylococcus phage Twort, complete genome) position: , mismatch: 8, identity: 0.778

ttaaaac-----aattttttacaccttctggaataacaaaa	CRISPR spacer
-----acttctggattttctacaccttctggaatatcaaaa	Protospacer
     **     .*****.**************** *****

4. spacer 1.94|1607949|36|NZ_CP014334|PILER-CR matches to MT151386 (Staphylococcus virus Twort, complete genome) position: , mismatch: 8, identity: 0.778

ttaaaac-----aattttttacaccttctggaataacaaaa	CRISPR spacer
-----acttctggattttctacaccttctggaatatcaaaa	Protospacer
     **     .*****.**************** *****

5. spacer 1.58|1607944|40|NZ_CP014334|CRT matches to NC_007021 (Staphylococcus phage Twort, complete genome) position: , mismatch: 11, identity: 0.725

gaacttaaaacaattttttacaccttctggaataacaaaa	CRISPR spacer
gaatacttctggattttctacaccttctggaatatcaaaa	Protospacer
***. .     .*****.**************** *****

6. spacer 1.58|1607944|40|NZ_CP014334|CRT matches to MT151386 (Staphylococcus virus Twort, complete genome) position: , mismatch: 11, identity: 0.725

gaacttaaaacaattttttacaccttctggaataacaaaa	CRISPR spacer
gaatacttctggattttctacaccttctggaatatcaaaa	Protospacer
***. .     .*****.**************** *****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 234393 : 306411 58 Streptococcus_phage(17.65%) transposase,tRNA,protease NA
DBSCAN-SWA_2 465912 : 473792 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_3 1054462 : 1065247 12 Bacillus_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage