Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009499 Mycobacterium intracellulare 1956, complete genome 7 crisprs DEDDh,cas3,csa3,DinG,cas4,WYL 0 1 376 0

Results visualization

1. NZ_CP009499
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009499_1 27127-27212 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009499_2 1454274-1454362 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009499_3 1485745-1485827 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009499_4 2403489-2403599 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009499_5 3478552-3478638 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009499_6 4614157-4614300 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009499_7 4731210-4731337 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 555402-555435 8 0.765
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 549521-549554 8 0.765
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 187854-187887 9 0.735
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 283810-283843 9 0.735
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 52186-52219 9 0.735
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 570738-570771 9 0.735
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1389609-1389642 9 0.735
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 143016-143049 9 0.735
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 279122-279155 9 0.735
NZ_CP009499_1 1.1|27153|34|NZ_CP009499|CRISPRCasFinder 27153-27186 34 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1561646-1561679 9 0.735

1. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.765

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacaca	Protospacer
* .***** * ******************.   *

2. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.765

gcgctggtcctggtagcccggctgcggcgggtaa-	CRISPR spacer
gaactggtgcaggtagcccggctgcgg-ggacacc	Protospacer
* .***** * **************** **..*  

3. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacacc	Protospacer
* .***** * ******************.    

4. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacacc	Protospacer
* .***** * ******************.    

5. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
gaactggtgcaggtagcccggctgcggcgacacc	Protospacer
* .***** * ******************.    

6. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

7. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

8. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

9. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

10. spacer 1.1|27153|34|NZ_CP009499|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.735

gcgctggtcctggtagcccggctgcggcgggtaa	CRISPR spacer
ctgatcgtcctgatcgcccggctgcggcgggagg	Protospacer
 .* * ******.* **************** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11106 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_2 15122 : 20018 6 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_3 38813 : 39632 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 49443 : 54408 4 Staphylococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_5 66181 : 67276 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_6 74884 : 78089 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_7 87916 : 91806 6 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_8 98343 : 99777 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_9 103971 : 104556 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_10 128911 : 129883 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_11 133433 : 134252 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_12 137638 : 144073 8 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_13 154082 : 155411 1 Feldmannia_species_virus(100.0%) NA NA
DBSCAN-SWA_14 165010 : 166885 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_15 181311 : 182526 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_16 189463 : 190087 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_17 198564 : 199824 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_18 212416 : 213607 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_19 219446 : 221555 2 Macacine_betaherpesvirus(100.0%) NA NA
DBSCAN-SWA_20 257091 : 257889 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_21 267516 : 268584 1 Pacmanvirus(100.0%) NA NA
DBSCAN-SWA_22 272982 : 281414 8 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_23 286425 : 287520 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_24 291165 : 291624 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_25 297794 : 301421 4 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_26 316106 : 317096 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_27 325231 : 325597 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_28 336410 : 337397 1 Cowpox_virus(100.0%) NA NA
DBSCAN-SWA_29 343604 : 346726 2 Bacteriophage(50.0%) NA NA
DBSCAN-SWA_30 353006 : 353999 1 Croceibacter_phage(100.0%) NA NA
DBSCAN-SWA_31 379911 : 380376 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 398094 : 401299 4 Tsukamurella_phage(50.0%) NA NA
DBSCAN-SWA_33 409441 : 411397 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 416585 : 418205 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_35 426387 : 434502 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_36 437862 : 442931 6 Cafeteria_roenbergensis_virus(33.33%) NA NA
DBSCAN-SWA_37 446475 : 447087 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_38 456565 : 460465 3 Bathycoccus_sp._RCC1105_virus(33.33%) NA NA
DBSCAN-SWA_39 466659 : 471501 3 Tupanvirus(33.33%) tRNA,protease NA
DBSCAN-SWA_40 481620 : 483030 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_41 489452 : 490274 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_42 507667 : 509203 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_43 518867 : 519773 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_44 532362 : 533295 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_45 549109 : 553968 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_46 587599 : 594271 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_47 612167 : 615193 2 Mollivirus(50.0%) NA NA
DBSCAN-SWA_48 625928 : 627011 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_49 638451 : 639465 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_50 643128 : 650522 6 Microbacterium_phage(33.33%) protease NA
DBSCAN-SWA_51 657629 : 663392 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_52 670839 : 671782 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_53 684793 : 685618 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_54 692511 : 694382 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_55 704963 : 707410 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_56 711689 : 713429 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_57 716576 : 719819 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_58 723653 : 724463 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_59 807935 : 811904 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_60 827303 : 828953 1 Acidianus_filamentous_virus(100.0%) NA NA
DBSCAN-SWA_61 833116 : 836644 5 Macacine_betaherpesvirus(50.0%) NA NA
DBSCAN-SWA_62 865794 : 868182 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_63 890601 : 894900 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_64 908121 : 914601 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_65 919906 : 922133 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_66 926327 : 927176 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_67 936957 : 944407 9 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_68 951962 : 953261 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_69 957523 : 959145 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_70 962647 : 963265 1 Pacmanvirus(100.0%) NA NA
DBSCAN-SWA_71 967131 : 968388 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_72 974569 : 975364 1 Ostreococcus_mediterraneus_virus(100.0%) NA NA
DBSCAN-SWA_73 982402 : 984100 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_74 993314 : 993887 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_75 1001426 : 1005127 3 Hokovirus(50.0%) tRNA NA
DBSCAN-SWA_76 1017107 : 1018433 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_77 1028318 : 1032896 6 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_78 1036413 : 1038564 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_79 1042095 : 1042869 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_80 1052285 : 1053917 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_81 1068662 : 1072093 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_82 1078095 : 1086737 9 Flavobacterium_phage(25.0%) NA NA
DBSCAN-SWA_83 1093314 : 1100863 5 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_84 1111949 : 1115271 3 Synechococcus_phage(66.67%) NA NA
DBSCAN-SWA_85 1118783 : 1120361 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_86 1139675 : 1140536 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_87 1156963 : 1157716 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_88 1161053 : 1161767 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_89 1173632 : 1175252 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_90 1182932 : 1185575 1 Mamastrovirus(100.0%) NA NA
DBSCAN-SWA_91 1200824 : 1202776 2 Moumouvirus(50.0%) NA NA
DBSCAN-SWA_92 1211009 : 1213396 2 Staphylococcus_phage(100.0%) transposase NA
DBSCAN-SWA_93 1219422 : 1220847 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_94 1239786 : 1245284 6 Staphylococcus_phage(33.33%) protease NA
DBSCAN-SWA_95 1254811 : 1255990 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_96 1269935 : 1276969 4 Beihai_Nido-like_virus(33.33%) NA NA
DBSCAN-SWA_97 1281619 : 1282846 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_98 1293459 : 1295834 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_99 1311269 : 1312208 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_100 1321241 : 1322648 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_101 1377433 : 1378933 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_102 1388546 : 1390109 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_103 1399366 : 1400884 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_104 1413422 : 1415033 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_105 1439563 : 1441165 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_106 1448112 : 1449249 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_107 1469290 : 1470736 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_108 1479707 : 1483574 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_109 1488363 : 1493988 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_110 1502789 : 1504625 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_111 1508836 : 1510678 1 Noumeavirus(100.0%) NA NA
DBSCAN-SWA_112 1517431 : 1518103 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_113 1529992 : 1530652 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_114 1551318 : 1557326 6 Mycobacterium_phage(40.0%) NA NA
DBSCAN-SWA_115 1568585 : 1571938 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_116 1577207 : 1584367 7 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_117 1591520 : 1592270 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_118 1599028 : 1600558 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_119 1630333 : 1631341 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_120 1643252 : 1644410 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_121 1654343 : 1655852 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_122 1668055 : 1669621 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_123 1677195 : 1677918 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_124 1701327 : 1703743 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_125 1707836 : 1709426 1 Pike_perch_iridovirus(100.0%) NA NA
DBSCAN-SWA_126 1719829 : 1721077 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_127 1729303 : 1731528 2 Propionibacterium_phage(50.0%) NA NA
DBSCAN-SWA_128 1740832 : 1746866 7 Cyanophage(33.33%) NA NA
DBSCAN-SWA_129 1750399 : 1754438 4 Agrobacterium_phage(33.33%) protease NA
DBSCAN-SWA_130 1759959 : 1766584 6 Streptomyces_phage(33.33%) tRNA NA
DBSCAN-SWA_131 1772154 : 1773258 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_132 1783526 : 1784810 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_133 1797201 : 1798329 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_134 1803234 : 1814259 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_135 1828504 : 1830376 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_136 1837358 : 1838441 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_137 1853796 : 1854960 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_138 1864806 : 1865610 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_139 1902419 : 1903883 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_140 1915873 : 1916953 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_141 1935916 : 1936537 1 Macacine_betaherpesvirus(100.0%) NA NA
DBSCAN-SWA_142 1939703 : 1940474 1 Niemeyer_virus(100.0%) NA NA
DBSCAN-SWA_143 1961489 : 1967933 3 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_144 1973085 : 1984097 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_145 1990308 : 1993404 3 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_146 2001486 : 2005183 5 Flavobacterium_phage(50.0%) tRNA NA
DBSCAN-SWA_147 2011559 : 2013512 1 Abalone_shriveling_syndrome-associated_virus(100.0%) NA NA
DBSCAN-SWA_148 2018467 : 2019400 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_149 2027712 : 2034737 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_150 2046142 : 2049960 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_151 2075912 : 2077847 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_152 2081135 : 2082266 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_153 2101825 : 2103325 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_154 2111804 : 2112983 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_155 2120797 : 2121790 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_156 2127465 : 2128947 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_157 2146948 : 2148034 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_158 2177563 : 2180549 4 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_159 2211241 : 2212789 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_160 2218442 : 2224330 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_161 2232410 : 2240903 7 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_162 2246712 : 2249894 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_163 2286250 : 2288641 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_164 2294703 : 2296959 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 2302395 : 2304768 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_166 2321152 : 2322388 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_167 2347169 : 2348681 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_168 2357883 : 2359623 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_169 2364209 : 2368004 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_170 2381492 : 2382863 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_171 2385985 : 2387815 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_172 2398892 : 2403464 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_173 2416188 : 2416944 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_174 2429019 : 2443577 4 Sulfolobus_monocaudavirus(50.0%) NA NA
DBSCAN-SWA_175 2458883 : 2459702 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_176 2463214 : 2464732 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_177 2471465 : 2472035 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_178 2477468 : 2479571 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_179 2498875 : 2499658 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_180 2510620 : 2511448 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_181 2531608 : 2532343 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_182 2542126 : 2542888 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_183 2548059 : 2549559 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_184 2552569 : 2556487 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_185 2576339 : 2577137 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_186 2596923 : 2597694 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_187 2619760 : 2622835 3 Burkholderia_virus(33.33%) NA NA
DBSCAN-SWA_188 2631495 : 2637078 7 Macacine_betaherpesvirus(66.67%) NA NA
DBSCAN-SWA_189 2653878 : 2658010 3 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_190 2675776 : 2676880 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_191 2684738 : 2687684 2 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_192 2701814 : 2704637 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2715295 : 2717215 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_194 2722499 : 2723216 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_195 2732915 : 2737784 3 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_196 2750119 : 2754283 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_197 2773323 : 2774859 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_198 2781213 : 2782578 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_199 2788867 : 2789677 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_200 2819324 : 2820938 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_201 2835377 : 2838044 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_202 2855793 : 2856801 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_203 2860624 : 2862253 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_204 2881417 : 2883199 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_205 2886542 : 2919694 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_206 2924704 : 2924908 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_207 2932832 : 2939725 7 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_208 2948262 : 2952478 4 Pectobacterium_phage(33.33%) tRNA NA
DBSCAN-SWA_209 2963527 : 2967264 3 Oenococcus_phage(50.0%) NA NA
DBSCAN-SWA_210 2973038 : 2985804 2 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_211 2991188 : 2992382 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_212 2998094 : 2999138 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_213 3003832 : 3008252 2 Vibrio_phage(50.0%) tRNA NA
DBSCAN-SWA_214 3014382 : 3015753 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_215 3019882 : 3023633 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_216 3029977 : 3038877 7 Bodo_saltans_virus(25.0%) NA NA
DBSCAN-SWA_217 3044325 : 3049627 4 Listeria_phage(50.0%) NA NA
DBSCAN-SWA_218 3055230 : 3056844 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_219 3067191 : 3068010 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_220 3076038 : 3077172 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_221 3097981 : 3103288 4 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_222 3117929 : 3125223 5 Catovirus(50.0%) NA NA
DBSCAN-SWA_223 3133570 : 3136684 1 Moumouvirus(100.0%) tRNA NA
DBSCAN-SWA_224 3164859 : 3182786 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_225 3193765 : 3206009 11 Shahe_endorna-like_virus(33.33%) NA NA
DBSCAN-SWA_226 3218063 : 3219527 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_227 3226274 : 3227042 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_228 3231335 : 3233532 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_229 3238379 : 3241251 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_230 3249544 : 3252133 3 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_231 3257423 : 3258332 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_232 3266482 : 3272081 6 Cyanophage(33.33%) NA NA
DBSCAN-SWA_233 3282887 : 3285778 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_234 3289953 : 3291938 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_235 3297825 : 3303759 6 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_236 3311521 : 3318279 7 Acanthamoeba_polyphaga_mimivirus(25.0%) NA NA
DBSCAN-SWA_237 3324047 : 3327941 4 Halovirus(50.0%) NA NA
DBSCAN-SWA_238 3333440 : 3334190 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_239 3346295 : 3347501 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_240 3351806 : 3358313 6 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_241 3369955 : 3373256 4 Rhodococcus_phage(50.0%) NA NA
DBSCAN-SWA_242 3380391 : 3398043 14 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_243 3401435 : 3403013 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_244 3410884 : 3412960 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_245 3438592 : 3440140 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_246 3462484 : 3463255 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_247 3487838 : 3488303 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_248 3491994 : 3507642 19 Cyanophage(33.33%) protease NA
DBSCAN-SWA_249 3520924 : 3521977 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_250 3529604 : 3531902 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_251 3537057 : 3541305 5 Gordonia_phage(66.67%) NA NA
DBSCAN-SWA_252 3564611 : 3565973 1 Acanthamoeba_polyphaga_lentillevirus(100.0%) NA NA
DBSCAN-SWA_253 3592337 : 3593945 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_254 3602208 : 3603588 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_255 3608491 : 3612276 4 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_256 3633048 : 3633888 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_257 3637848 : 3639027 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_258 3644281 : 3645178 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_259 3656009 : 3656729 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_260 3662108 : 3662996 1 Erythrobacter_phage(100.0%) NA NA
DBSCAN-SWA_261 3669303 : 3671067 1 Saccharomonospora_phage(100.0%) NA NA
DBSCAN-SWA_262 3676638 : 3677970 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_263 3683389 : 3684932 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_264 3689877 : 3694913 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_265 3707456 : 3708140 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_266 3716275 : 3716923 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_267 3727066 : 3728653 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_268 3732339 : 3734208 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_269 3740041 : 3741073 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_270 3750641 : 3752723 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_271 3756495 : 3757674 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_272 3785407 : 3786736 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_273 3794461 : 3795304 1 Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_274 3799858 : 3802360 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_275 3806793 : 3813369 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_276 3825737 : 3827264 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_277 3843357 : 3844185 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_278 3847219 : 3849078 2 Diadromus_pulchellus_ascovirus(50.0%) NA NA
DBSCAN-SWA_279 3857186 : 3857564 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_280 3866664 : 3868128 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_281 3878423 : 3879881 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_282 3886918 : 3900249 12 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_283 3908538 : 3909336 1 Niemeyer_virus(100.0%) NA NA
DBSCAN-SWA_284 3953563 : 3954529 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_285 3958208 : 3960311 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_286 3974042 : 3974702 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_287 3978517 : 3980311 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_288 3995839 : 3999088 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_289 4016884 : 4018438 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_290 4033845 : 4042447 6 Propionibacterium_phage(33.33%) NA NA
DBSCAN-SWA_291 4053380 : 4057168 3 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_292 4061233 : 4064627 5 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_293 4069030 : 4069780 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_294 4096846 : 4101518 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_295 4111997 : 4112336 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_296 4117300 : 4133278 14 Enterobacteria_phage(16.67%) NA NA
DBSCAN-SWA_297 4136821 : 4141582 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_298 4156643 : 4160551 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_299 4174044 : 4175175 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_300 4186310 : 4187894 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_301 4196501 : 4197785 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_302 4206106 : 4207348 1 Erythrobacter_phage(100.0%) NA NA
DBSCAN-SWA_303 4217278 : 4218667 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_304 4228324 : 4230676 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_305 4238203 : 4241491 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_306 4246432 : 4247320 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_307 4254350 : 4255895 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_308 4265740 : 4267336 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_309 4270428 : 4270731 1 Mycobacterium_virus(100.0%) NA NA
DBSCAN-SWA_310 4276704 : 4279985 3 uncultured_virus(66.67%) tRNA NA
DBSCAN-SWA_311 4288598 : 4290464 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_312 4299832 : 4306338 3 Mycobacterium_phage(100.0%) protease NA
DBSCAN-SWA_313 4314276 : 4324647 8 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_314 4333340 : 4334396 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_315 4337880 : 4338576 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_316 4345764 : 4346310 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_317 4350890 : 4351871 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_318 4367176 : 4368067 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_319 4378477 : 4379923 1 Acanthamoeba_castellanii_mimivirus(100.0%) NA NA
DBSCAN-SWA_320 4386853 : 4387678 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_321 4393092 : 4396499 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_322 4405305 : 4414237 3 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_323 4425537 : 4429776 4 Micromonas_pusilla_virus(33.33%) NA NA
DBSCAN-SWA_324 4442525 : 4445333 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_325 4449699 : 4454720 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_326 4472826 : 4477419 4 Mycobacterium_phage(50.0%) transposase NA
DBSCAN-SWA_327 4500978 : 4502580 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_328 4508996 : 4510136 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_329 4517022 : 4518051 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_330 4531861 : 4535428 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_331 4543744 : 4544983 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_332 4556803 : 4557730 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_333 4566335 : 4568280 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_334 4583620 : 4585408 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_335 4591443 : 4592841 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_336 4600179 : 4601792 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_337 4614372 : 4615998 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_338 4624293 : 4626480 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_339 4635308 : 4635617 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_340 4638736 : 4643176 1 Only_Syngen_Nebraska_virus(100.0%) NA NA
DBSCAN-SWA_341 4650896 : 4652282 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_342 4655915 : 4659283 3 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_343 4664727 : 4665495 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_344 4671364 : 4676225 3 Myeloproliferative_sarcoma_virus(50.0%) transposase NA
DBSCAN-SWA_345 4693792 : 4695091 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_346 4706626 : 4707166 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_347 4710345 : 4712892 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_348 4716130 : 4719856 3 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_349 4734422 : 4740719 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_350 4745776 : 4746972 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_351 4761303 : 4762131 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_352 4777918 : 4779328 1 Mycobacterium_phage(100.0%) protease NA
DBSCAN-SWA_353 4784246 : 4791702 3 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_354 4809288 : 4810977 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_355 4826944 : 4828888 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_356 4851454 : 4852825 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_357 4858447 : 4860094 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_358 4876791 : 4878021 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_359 4881875 : 4883393 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_360 4887158 : 4888331 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_361 4918030 : 4920019 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_362 4929128 : 4929785 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_363 4956448 : 4961118 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_364 4979434 : 4980178 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_365 5002295 : 5003621 1 Cotesia_sesamiae_Mombasa_bracovirus(100.0%) NA NA
DBSCAN-SWA_366 5020435 : 5023366 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_367 5033292 : 5040703 4 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_368 5045804 : 5051204 3 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_369 5062445 : 5065129 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_370 5069230 : 5075698 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_371 5105138 : 5107409 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_372 5132497 : 5133391 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_373 5151943 : 5154270 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_374 5161025 : 5162468 1 Mycobacterium_phage(100.0%) tRNA NA
DBSCAN-SWA_375 5173285 : 5174646 2 Orpheovirus(50.0%) NA NA
DBSCAN-SWA_376 5178039 : 5179008 1 Natrialba_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage