Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009652 Mycoplasma hominis ATCC 27545, complete genome 4 crisprs NA 0 2 1 0

Results visualization

1. NZ_CP009652
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009652_1 113305-113412 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009652_2 274831-274925 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009652_3 409605-409714 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009652_4 595644-595924 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009652_1 1.1|113337|44|NZ_CP009652|CRISPRCasFinder 113337-113380 44 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 664655-664698 0 1.0
NZ_CP009652_3 3.1|409646|28|NZ_CP009652|CRISPRCasFinder 409646-409673 28 NZ_CP040821 Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence 116401-116428 5 0.821
NZ_CP009652_1 1.1|113337|44|NZ_CP009652|CRISPRCasFinder 113337-113380 44 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1581498-1581541 12 0.727

1. spacer 1.1|113337|44|NZ_CP009652|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 0, identity: 1.0

cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	CRISPR spacer
cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	Protospacer
********************************************

2. spacer 3.1|409646|28|NZ_CP009652|CRISPRCasFinder matches to NZ_CP040821 (Paraoceanicella profunda strain D4M1 plasmid pD4M1C, complete sequence) position: , mismatch: 5, identity: 0.821

tggagctggaggggttggttgaggttgg--	CRISPR spacer
tggagctggaggggctggtggag--cggct	Protospacer
**************.**** ***  .**  

3. spacer 1.1|113337|44|NZ_CP009652|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 12, identity: 0.727

cttgcaccattgcggatgtagttcaatggtagaacatcaggttg	CRISPR spacer
atctttcttttgcgggtgtagttcaatggtagaacttcagcctt	Protospacer
 *. . *. ******.******************* **** .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 598939 : 606968 6 Mycoplasma_phage(83.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage