Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009796 Bacillus subtilis strain SG6, complete genome 2 crisprs csa3,cas3,DEDDh,WYL,DinG 0 1 309 0

Results visualization

1. NZ_CP009796
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009796_1 900098-900203 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009796_2 3029034-3029141 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NZ_CP009796_2 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder 3029058-3029117 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 2.1|3029058|60|NZ_CP009796|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5760 5 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_2 8804 : 10496 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_3 18390 : 31856 15 Streptococcus_phage(42.86%) tRNA NA
DBSCAN-SWA_4 38266 : 40613 2 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_5 46014 : 46551 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 58899 : 66790 7 Micromonas_pusilla_virus(25.0%) protease NA
DBSCAN-SWA_7 70642 : 72142 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_8 79810 : 82243 1 Klebsiella_phage(100.0%) protease NA
DBSCAN-SWA_9 89688 : 91089 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_10 94128 : 94662 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_11 98157 : 109001 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_12 126680 : 128371 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_13 132846 : 133560 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_14 142868 : 144305 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_15 166062 : 170678 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_16 180750 : 183480 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_17 192502 : 193384 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_18 213396 : 215292 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_19 236869 : 239502 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_20 244540 : 245269 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_21 254921 : 255662 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_22 262298 : 264046 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_23 267840 : 273293 7 Caulobacter_phage(60.0%) NA NA
DBSCAN-SWA_24 279537 : 280794 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_25 296831 : 297650 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_26 302122 : 304006 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_27 311402 : 312413 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_28 316846 : 318979 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_29 328800 : 360902 10 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_30 364672 : 368492 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_31 374777 : 378290 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_32 385118 : 393557 10 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_33 400113 : 404672 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_34 427965 : 431108 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_35 435099 : 437283 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_36 446852 : 449093 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_37 461442 : 462369 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_38 466289 : 466610 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 469693 : 471178 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_40 477422 : 477773 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_41 481342 : 482131 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_42 485515 : 485968 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_43 489190 : 494344 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_44 506476 : 508236 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_45 514879 : 515752 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_46 520102 : 521410 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 544966 : 546613 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_48 552425 : 553055 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_49 558330 : 559518 1 Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_50 568867 : 570265 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_51 582064 : 635138 78 uncultured_Caudovirales_phage(34.09%) tail,holin,portal,terminase,tRNA,integrase,protease,capsid,head attL 592453:592472|attR 635342:635361
DBSCAN-SWA_52 653903 : 654725 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_53 665104 : 682497 17 Synechococcus_phage(30.0%) NA NA
DBSCAN-SWA_54 691736 : 699100 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_55 705323 : 724988 12 Liberibacter_phage(28.57%) NA NA
DBSCAN-SWA_56 731609 : 733343 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_57 764890 : 772418 4 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_58 780773 : 791944 10 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_59 807023 : 807161 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_60 810287 : 812237 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_61 841572 : 842973 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_62 853382 : 853712 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_63 860882 : 864412 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_64 867966 : 868902 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_65 891877 : 893959 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_66 901500 : 903243 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_67 919853 : 924309 4 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_68 935303 : 938557 2 Thermus_phage(50.0%) NA NA
DBSCAN-SWA_69 943751 : 948961 6 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_70 957762 : 960526 4 Bodo_saltans_virus(33.33%) NA NA
DBSCAN-SWA_71 964637 : 965462 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_72 968908 : 970654 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_73 973929 : 975396 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_74 981136 : 985239 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_75 999703 : 1003234 5 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_76 1007714 : 1012632 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_77 1017141 : 1017495 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_78 1024987 : 1025884 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_79 1037682 : 1040577 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_80 1063377 : 1067966 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_81 1072876 : 1081031 8 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_82 1090673 : 1091999 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_83 1102194 : 1110529 3 Clostridium_botulinum_C_phage(50.0%) NA NA
DBSCAN-SWA_84 1116175 : 1121462 3 Bacillus_phage(50.0%) protease NA
DBSCAN-SWA_85 1131415 : 1134015 3 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_86 1150073 : 1150925 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_87 1155001 : 1156663 2 Bacteriophage(50.0%) NA NA
DBSCAN-SWA_88 1160472 : 1162762 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_89 1165834 : 1166794 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_90 1170190 : 1221985 60 Bacillus_phage(30.0%) tRNA,coat NA
DBSCAN-SWA_91 1226333 : 1231345 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_92 1255845 : 1259789 5 Leucania_separata_nucleopolyhedrovirus(33.33%) NA NA
DBSCAN-SWA_93 1269852 : 1270689 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_94 1277741 : 1311782 46 Bacillus_phage(27.27%) terminase,holin,portal,plate NA
DBSCAN-SWA_95 1319981 : 1322829 2 Salmonella_phage(50.0%) protease NA
DBSCAN-SWA_96 1326684 : 1327692 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_97 1331484 : 1333377 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_98 1342042 : 1357560 15 Streptococcus_phage(33.33%) protease NA
DBSCAN-SWA_99 1367031 : 1370845 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_100 1374385 : 1377546 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_101 1382763 : 1385474 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_102 1399179 : 1407150 8 Pneumococcus_phage(40.0%) protease NA
DBSCAN-SWA_103 1412092 : 1422877 9 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_104 1427217 : 1438125 8 uncultured_Caudovirales_phage(25.0%) NA NA
DBSCAN-SWA_105 1441680 : 1442445 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_106 1447299 : 1449130 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_107 1453135 : 1453582 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_108 1460149 : 1466369 5 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_109 1472636 : 1474259 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_110 1478127 : 1479882 2 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_111 1485643 : 1487007 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_112 1492126 : 1493539 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_113 1506377 : 1511050 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_114 1526640 : 1530825 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_115 1559542 : 1567613 5 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_116 1573615 : 1584006 9 Moumouvirus(25.0%) tRNA NA
DBSCAN-SWA_117 1589574 : 1594217 5 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_118 1598219 : 1608209 9 Acanthocystis_turfacea_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_119 1611398 : 1613345 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_120 1624769 : 1626716 3 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_121 1637707 : 1638475 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_122 1642836 : 1650336 6 Thermus_phage(25.0%) tRNA,protease NA
DBSCAN-SWA_123 1676749 : 1677514 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_124 1681470 : 1682253 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_125 1687389 : 1699042 10 Clostridium_phage(33.33%) tRNA NA
DBSCAN-SWA_126 1702873 : 1704103 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_127 1712534 : 1720643 6 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_128 1724906 : 1732957 7 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_129 1736006 : 1740482 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_130 1753041 : 1824402 11 Paenibacillus_phage(71.43%) protease NA
DBSCAN-SWA_131 1828862 : 1835434 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_132 1854533 : 1857490 5 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_133 1866523 : 1867159 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_134 1871226 : 1874246 4 Bacillus_phage(100.0%) coat NA
DBSCAN-SWA_135 1888077 : 1891108 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_136 1906329 : 1910721 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_137 1919559 : 1920453 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_138 1927382 : 1929032 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_139 1932993 : 1970741 5 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_140 1976181 : 1980243 4 Bacillus_phage(50.0%) integrase attL 1956501:1956514|attR 1977052:1977065
DBSCAN-SWA_141 1988578 : 1992058 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_142 1996834 : 1997869 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_143 2002220 : 2003906 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_144 2008829 : 2009513 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_145 2021291 : 2030910 10 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_146 2035476 : 2036841 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_147 2046058 : 2052930 4 Bacillus_phage(75.0%) NA NA
DBSCAN-SWA_148 2057371 : 2060284 4 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_149 2067211 : 2070098 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_150 2078376 : 2079222 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_151 2088082 : 2092576 4 Halovirus(33.33%) NA NA
DBSCAN-SWA_152 2108869 : 2109691 1 Freshwater_phage(100.0%) NA NA
DBSCAN-SWA_153 2125925 : 2126951 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_154 2136504 : 2138419 3 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_155 2143821 : 2144439 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_156 2147805 : 2151786 9 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_157 2167385 : 2169311 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_158 2174479 : 2176729 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_159 2180697 : 2181318 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_160 2185343 : 2196985 11 Bacillus_phage(40.0%) tRNA NA
DBSCAN-SWA_161 2200541 : 2201414 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_162 2205647 : 2206187 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_163 2210325 : 2215811 6 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_164 2219014 : 2225736 9 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_165 2239070 : 2239988 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_166 2246841 : 2257823 10 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_167 2263302 : 2271263 10 Staphylococcus_phage(57.14%) NA NA
DBSCAN-SWA_168 2275111 : 2275543 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_169 2283191 : 2289244 7 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_170 2301954 : 2306656 5 Erysipelothrix_phage(33.33%) NA NA
DBSCAN-SWA_171 2314482 : 2315785 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_172 2331037 : 2338998 7 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_173 2347677 : 2353507 6 Oenococcus_phage(25.0%) NA NA
DBSCAN-SWA_174 2358673 : 2361677 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_175 2370091 : 2370814 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_176 2393683 : 2398348 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_177 2406441 : 2408777 2 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_178 2421961 : 2430971 8 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_179 2448094 : 2450011 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_180 2456729 : 2458332 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_181 2464954 : 2465563 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_182 2471769 : 2481819 9 Bodo_saltans_virus(20.0%) tRNA NA
DBSCAN-SWA_183 2492978 : 2493938 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_184 2498393 : 2498840 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_185 2503267 : 2511231 6 Catovirus(33.33%) NA NA
DBSCAN-SWA_186 2516025 : 2518929 2 Clostridium_botulinum_C_phage(50.0%) NA NA
DBSCAN-SWA_187 2522247 : 2522817 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_188 2527387 : 2547850 17 Bacillus_phage(55.56%) NA NA
DBSCAN-SWA_189 2554449 : 2555424 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_190 2569755 : 2570316 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_191 2577628 : 2578666 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_192 2590579 : 2591434 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2602954 : 2603788 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_194 2611295 : 2615064 3 Tupanvirus(50.0%) protease NA
DBSCAN-SWA_195 2626311 : 2632048 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_196 2639995 : 2642060 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_197 2647212 : 2658082 11 Catovirus(20.0%) tRNA NA
DBSCAN-SWA_198 2661280 : 2663677 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_199 2667331 : 2684107 13 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_200 2687417 : 2741192 57 uncultured_Mediterranean_phage(22.22%) tRNA,coat,protease NA
DBSCAN-SWA_201 2747286 : 2752121 4 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_202 2757163 : 2757760 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_203 2761345 : 2761570 1 Caldibacillus_phage(100.0%) NA NA
DBSCAN-SWA_204 2769642 : 2769957 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_205 2775261 : 2781642 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_206 2786207 : 2787242 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_207 2809603 : 2810125 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_208 2813258 : 2823560 9 Enterobacteria_phage(25.0%) tRNA NA
DBSCAN-SWA_209 2826801 : 2837752 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_210 2841553 : 2843311 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_211 2848034 : 2851382 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_212 2857750 : 2861890 5 Indivirus(50.0%) NA NA
DBSCAN-SWA_213 2876804 : 2882420 5 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_214 2890462 : 2896707 5 Bacillus_phage(33.33%) tRNA NA
DBSCAN-SWA_215 2902220 : 2903297 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_216 2906500 : 2910949 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_217 2923225 : 2928884 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_218 2932141 : 2935131 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_219 2948959 : 2951465 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_220 2959404 : 2968864 7 Staphylococcus_phage(66.67%) tRNA NA
DBSCAN-SWA_221 2972054 : 2995100 28 Staphylococcus_phage(58.33%) holin NA
DBSCAN-SWA_222 3001043 : 3005587 4 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_223 3011511 : 3014735 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_224 3020511 : 3022908 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_225 3037701 : 3039231 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_226 3048069 : 3048918 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_227 3061317 : 3069684 4 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_228 3076103 : 3077090 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_229 3084825 : 3085647 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_230 3098349 : 3103382 4 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_231 3116704 : 3118177 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_232 3127220 : 3131708 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_233 3138025 : 3145162 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_234 3153925 : 3168229 18 Mycoplasma_phage(14.29%) protease NA
DBSCAN-SWA_235 3175008 : 3175509 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_236 3178960 : 3179941 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_237 3188007 : 3190655 2 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_238 3202499 : 3203603 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_239 3208596 : 3209583 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_240 3214562 : 3224682 15 Mycobacterium_phage(20.0%) NA NA
DBSCAN-SWA_241 3230492 : 3231401 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_242 3234771 : 3237692 4 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_243 3241318 : 3244153 3 Clostridium_phage(33.33%) protease NA
DBSCAN-SWA_244 3258896 : 3261286 2 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_245 3264369 : 3266822 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_246 3271104 : 3273951 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_247 3279578 : 3285387 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_248 3297590 : 3302267 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_249 3309986 : 3329701 24 Thermus_phage(25.0%) holin NA
DBSCAN-SWA_250 3335253 : 3336546 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_251 3350352 : 3351387 1 Microbacterium_phage(100.0%) NA NA
DBSCAN-SWA_252 3357048 : 3357954 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_253 3365395 : 3366388 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_254 3371799 : 3372966 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_255 3381154 : 3384941 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_256 3390855 : 3395795 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_257 3402972 : 3404303 2 Agrobacterium_phage(50.0%) NA NA
DBSCAN-SWA_258 3415690 : 3418322 3 Catovirus(33.33%) NA NA
DBSCAN-SWA_259 3422246 : 3423026 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_260 3426323 : 3436253 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_261 3448023 : 3448542 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_262 3462665 : 3465539 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_263 3477421 : 3478108 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_264 3488570 : 3488795 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_265 3494690 : 3499930 5 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_266 3503620 : 3508049 4 Catovirus(50.0%) NA NA
DBSCAN-SWA_267 3511669 : 3520681 7 Paenibacillus_phage(20.0%) NA NA
DBSCAN-SWA_268 3526127 : 3533017 5 Hokovirus(33.33%) NA NA
DBSCAN-SWA_269 3538081 : 3543047 4 Aichi_virus(50.0%) NA NA
DBSCAN-SWA_270 3549230 : 3550712 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_271 3557047 : 3559495 2 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_272 3570052 : 3588092 19 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_273 3595955 : 3596237 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_274 3607237 : 3608110 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_275 3618570 : 3619704 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_276 3624279 : 3625311 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_277 3636747 : 3641567 6 Aeromonas_phage(50.0%) NA NA
DBSCAN-SWA_278 3644642 : 3645713 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_279 3649962 : 3650550 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_280 3655311 : 3659858 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_281 3665420 : 3669039 4 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_282 3672382 : 3673846 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_283 3681222 : 3761881 83 Bacillus_phage(25.0%) bacteriocin,tRNA,coat,protease NA
DBSCAN-SWA_284 3787248 : 3796845 8 Streptococcus_phage(33.33%) protease NA
DBSCAN-SWA_285 3806340 : 3809036 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_286 3819056 : 3823663 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_287 3827422 : 3830850 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_288 3838190 : 3845257 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_289 3850775 : 3853298 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_290 3860953 : 3863014 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_291 3868793 : 3870233 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_292 3884565 : 3885309 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_293 3896394 : 3897921 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_294 3903351 : 3904653 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_295 3912371 : 3913121 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_296 3916914 : 3917901 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_297 3924767 : 3925541 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_298 3943804 : 3945685 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_299 3953183 : 3955427 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_300 3966331 : 3967480 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_301 3971338 : 3975330 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_302 3979229 : 3979859 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_303 3985056 : 3989738 6 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_304 3992972 : 4011422 15 Bacillus_phage(33.33%) protease NA
DBSCAN-SWA_305 4033060 : 4033582 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_306 4043833 : 4045458 3 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_307 4050936 : 4054803 5 Bacillus_virus(25.0%) protease NA
DBSCAN-SWA_308 4063599 : 4071120 6 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_309 4077574 : 4079041 1 Klosneuvirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage