Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009851 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-c88, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP009853 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pKPC-860, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP009852 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4 plasmid pENT-e56, complete sequence 0 crisprs DEDDh 0 0 1 0
NZ_CP009850 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH4, complete genome 4 crisprs RT,csa3,DinG,DEDDh,PD-DExK,cas3,cas6f,cas7f,cas5f,cas8f,cas3f,cas1,WYL 0 14 5 0

Results visualization

1. NZ_CP009851
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 17370 14 Enterobacteria_phage(28.57%) transposase NA
DBSCAN-SWA_2 37796 : 45381 10 Wolbachia_phage(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009853
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 55098 59 Burkholderia_phage(18.75%) integrase,transposase,protease attL 2606:2623|attR 9790:9807
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009850
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009850_1 3168670-3169477 TypeI-F I-F
13 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009850_2 3177439-3177948 TypeI-F I-F
8 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009850_3 3192981-3193188 TypeI-F I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009850_4 3630177-3630322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009850_1 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder 3168698-3168729 32 NC_016158 Escherichia phage HK639, complete genome 42284-42315 1 0.969
NZ_CP009850_1 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder 3168698-3168729 32 MN856003 Bacteriophage sp. isolate 1, complete genome 29138-29169 1 0.969
NZ_CP009850_2 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT 3177467-3177498 32 M11919 Bacteriophage phi-80 cI immunity region encoding the N gene 640-671 2 0.938
NZ_CP009850_2 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT 3177467-3177498 32 MN856003 Bacteriophage sp. isolate 1, complete genome 37224-37255 2 0.938
NZ_CP009850_2 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT 3177467-3177498 32 NC_021190 Enterobacteria phage phi80, complete genome 33169-33200 2 0.938
NZ_CP009850_2 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT 3177467-3177498 32 NC_019717 Enterobacteria phage HK225, complete genome 31517-31548 2 0.938
NZ_CP009850_2 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT 3177467-3177498 32 X13065 Bacteriophage phi80 early region 1107-1138 2 0.938
NZ_CP009850_1 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder 3168698-3168729 32 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 46889-46920 4 0.875
NZ_CP009850_1 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder 3168698-3168729 32 X92588 Bacteriophage 82 orf33, orf151, orf56, orf96, rus, orf45, and Q genes 93-124 4 0.875
NZ_CP009850_1 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder 3168698-3168729 32 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 43041-43072 4 0.875
NZ_CP009850_1 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder 3168698-3168729 32 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 43324-43355 4 0.875
NZ_CP009850_1 1.14|3168695|35|NZ_CP009850|CRT 3168695-3168729 35 MN856003 Bacteriophage sp. isolate 1, complete genome 29138-29172 4 0.886
NZ_CP009850_1 1.14|3168695|35|NZ_CP009850|CRT 3168695-3168729 35 NC_016158 Escherichia phage HK639, complete genome 42281-42315 4 0.886
NZ_CP009850_4 4.1|3630230|40|NZ_CP009850|CRISPRCasFinder 3630230-3630269 40 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 167180-167219 4 0.9
NZ_CP009850_4 4.1|3630230|40|NZ_CP009850|CRISPRCasFinder 3630230-3630269 40 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 9765-9804 4 0.9
NZ_CP009850_1 1.12|3169358|32|NZ_CP009850|CRISPRCasFinder 3169358-3169389 32 NZ_CP018612 Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD01, complete sequence 11036-11067 7 0.781
NZ_CP009850_1 1.12|3169358|32|NZ_CP009850|CRISPRCasFinder 3169358-3169389 32 NZ_CP018613 Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD02, complete sequence 10381-10412 7 0.781
NZ_CP009850_1 1.14|3168695|35|NZ_CP009850|CRT 3168695-3168729 35 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 46886-46920 7 0.8
NZ_CP009850_1 1.14|3168695|35|NZ_CP009850|CRT 3168695-3168729 35 X92588 Bacteriophage 82 orf33, orf151, orf56, orf96, rus, orf45, and Q genes 90-124 7 0.8
NZ_CP009850_1 1.14|3168695|35|NZ_CP009850|CRT 3168695-3168729 35 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 43038-43072 7 0.8
NZ_CP009850_1 1.14|3168695|35|NZ_CP009850|CRT 3168695-3168729 35 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 43321-43355 7 0.8
NZ_CP009850_2 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3177587-3177618 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 165109-165140 7 0.781
NZ_CP009850_3 3.2|3193069|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3193069-3193100 32 MK388859 Klebsiella phage ST405-OXA48phi1.1, complete genome 26866-26897 7 0.781
NZ_CP009850_3 3.3|3193129|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3193129-3193160 32 MH518298 Pseudomonas phage SCYZ1, complete genome 46426-46457 7 0.781
NZ_CP009850_1 1.11|3169298|32|NZ_CP009850|CRISPRCasFinder 3169298-3169329 32 NZ_CP022193 Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence 70460-70491 8 0.75
NZ_CP009850_2 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3177587-3177618 32 MT310894 Microbacterium phage Tempo, complete genome 41003-41034 8 0.75
NZ_CP009850_1 1.2|3168758|32|NZ_CP009850|CRISPRCasFinder 3168758-3168789 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2590628-2590659 9 0.719
NZ_CP009850_1 1.3|3168818|32|NZ_CP009850|CRISPRCasFinder 3168818-3168849 32 NZ_CP026333 Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence 208432-208463 9 0.719
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 MN693267 Marine virus AFVG_25M289, complete genome 35573-35604 9 0.719
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 MN693101 Marine virus AFVG_25M559, complete genome 19033-19064 9 0.719
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 NC_042044 Salmonella phage Melville, complete genome 29919-29950 9 0.719
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 NZ_CP038171 Enterococcus faecium strain SDGJP3 plasmid pSDGJP3, complete sequence 47970-48001 9 0.719
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 NZ_CP038176 Enterococcus faecium strain HN11 plasmid pHN11, complete sequence 24221-24252 9 0.719
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 NZ_MH784601 Enterococcus faecium strain 25 plasmid pC25-1, complete sequence 6885-6916 9 0.719
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 NZ_MH784602 Enterococcus faecium strain 27 plasmid pC27-2, complete sequence 6885-6916 9 0.719
NZ_CP009850_1 1.11|3169298|32|NZ_CP009850|CRISPRCasFinder 3169298-3169329 32 MH019216 Streptomyces phage Wentworth, complete genome 31307-31338 9 0.719
NZ_CP009850_1 1.13|3169418|32|NZ_CP009850|CRISPRCasFinder 3169418-3169449 32 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 90257-90288 9 0.719
NZ_CP009850_2 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3177587-3177618 32 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 198017-198048 9 0.719
NZ_CP009850_2 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3177587-3177618 32 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 207573-207604 9 0.719
NZ_CP009850_2 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3177587-3177618 32 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 489781-489812 9 0.719
NZ_CP009850_2 2.8|3177889|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR 3177889-3177920 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 259220-259251 9 0.719
NZ_CP009850_4 4.1|3630230|40|NZ_CP009850|CRISPRCasFinder 3630230-3630269 40 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 422250-422289 9 0.775
NZ_CP009850_1 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder 3168698-3168729 32 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 441459-441490 10 0.688
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 MN698247 Pelagibacter phage HTVC115P, complete genome 32036-32067 10 0.688
NZ_CP009850_1 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder 3168938-3168969 32 AP013455 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C40 4502-4533 11 0.656

1. spacer 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder matches to NC_016158 (Escherichia phage HK639, complete genome) position: , mismatch: 1, identity: 0.969

ctgaacaacttcggtgacttctgcgcatttaa	CRISPR spacer
ctgaacaactccggtgacttctgcgcatttaa	Protospacer
**********.*********************

2. spacer 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 1, identity: 0.969

ctgaacaacttcggtgacttctgcgcatttaa	CRISPR spacer
ctgaacaactccggtgacttctgcgcatttaa	Protospacer
**********.*********************

3. spacer 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT matches to M11919 (Bacteriophage phi-80 cI immunity region encoding the N gene) position: , mismatch: 2, identity: 0.938

acttcgctcagttgtcgatgtttcctttcgat	CRISPR spacer
acttcgctcagctgtcgatgtttcgtttcgat	Protospacer
***********.************ *******

4. spacer 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 2, identity: 0.938

acttcgctcagttgtcgatgtttcctttcgat	CRISPR spacer
acttcgctcagctgtcgatgtttcgtttcgat	Protospacer
***********.************ *******

5. spacer 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT matches to NC_021190 (Enterobacteria phage phi80, complete genome) position: , mismatch: 2, identity: 0.938

acttcgctcagttgtcgatgtttcctttcgat	CRISPR spacer
acttcgctcagctgtcgatgtttcgtttcgat	Protospacer
***********.************ *******

6. spacer 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT matches to NC_019717 (Enterobacteria phage HK225, complete genome) position: , mismatch: 2, identity: 0.938

acttcgctcagttgtcgatgtttcctttcgat	CRISPR spacer
acttcgctcagctgtcgatgtttcgtttcgat	Protospacer
***********.************ *******

7. spacer 2.1|3177467|32|NZ_CP009850|CRISPRCasFinder,CRT matches to X13065 (Bacteriophage phi80 early region) position: , mismatch: 2, identity: 0.938

acttcgctcagttgtcgatgtttcctttcgat	CRISPR spacer
acttcgctcagctgtcgatgtttcgtttcgat	Protospacer
***********.************ *******

8. spacer 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 4, identity: 0.875

ctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
ctgaacaactccggtgacttctgcgc---taaacg	Protospacer
**********.***************   ***   

9. spacer 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder matches to X92588 (Bacteriophage 82 orf33, orf151, orf56, orf96, rus, orf45, and Q genes) position: , mismatch: 4, identity: 0.875

ctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
ctgaacaactccggtgacttctgcgc---taaacg	Protospacer
**********.***************   ***   

10. spacer 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 4, identity: 0.875

ctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
ctgaacaactccggtgacttctgcgc---taaacg	Protospacer
**********.***************   ***   

11. spacer 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 4, identity: 0.875

ctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
ctgaacaactccggtgacttctgcgc---taaacg	Protospacer
**********.***************   ***   

12. spacer 1.14|3168695|35|NZ_CP009850|CRT matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 4, identity: 0.886

gagctgaacaacttcggtgacttctgcgcatttaa	CRISPR spacer
agcctgaacaactccggtgacttctgcgcatttaa	Protospacer
.. **********.*********************

13. spacer 1.14|3168695|35|NZ_CP009850|CRT matches to NC_016158 (Escherichia phage HK639, complete genome) position: , mismatch: 4, identity: 0.886

gagctgaacaacttcggtgacttctgcgcatttaa	CRISPR spacer
agcctgaacaactccggtgacttctgcgcatttaa	Protospacer
.. **********.*********************

14. spacer 4.1|3630230|40|NZ_CP009850|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 4, identity: 0.9

tgtgcggtctgatgccctcaccctggccctctcccacgga	CRISPR spacer
ggtgcggtctgatgccctcaccccgaccctctcccacggg	Protospacer
 **********************.*.*************.

15. spacer 4.1|3630230|40|NZ_CP009850|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 4, identity: 0.9

tgtgcggtctgatgccctcaccctggccctctcccacgga	CRISPR spacer
cgtgcggtctgatgccctcaccccggccctctcccacagg	Protospacer
.**********************.*************.*.

16. spacer 1.12|3169358|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP018612 (Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD01, complete sequence) position: , mismatch: 7, identity: 0.781

ccagaaa---acgactggttttaagccatctggac	CRISPR spacer
---gacaccttcgagtgcttttaagccatctggac	Protospacer
   ** *    *** ** *****************

17. spacer 1.12|3169358|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP018613 (Lactobacillus delbrueckii subsp. indicus strain JCM 15610 plasmid pLD02, complete sequence) position: , mismatch: 7, identity: 0.781

ccagaaa---acgactggttttaagccatctggac	CRISPR spacer
---gacaccttcgagtgcttttaagccatctggac	Protospacer
   ** *    *** ** *****************

18. spacer 1.14|3168695|35|NZ_CP009850|CRT matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 7, identity: 0.8

gagctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
agcctgaacaactccggtgacttctgcgc---taaacg	Protospacer
.. **********.***************   ***   

19. spacer 1.14|3168695|35|NZ_CP009850|CRT matches to X92588 (Bacteriophage 82 orf33, orf151, orf56, orf96, rus, orf45, and Q genes) position: , mismatch: 7, identity: 0.8

gagctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
agcctgaacaactccggtgacttctgcgc---taaacg	Protospacer
.. **********.***************   ***   

20. spacer 1.14|3168695|35|NZ_CP009850|CRT matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.8

gagctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
agcctgaacaactccggtgacttctgcgc---taaacg	Protospacer
.. **********.***************   ***   

21. spacer 1.14|3168695|35|NZ_CP009850|CRT matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.8

gagctgaacaacttcggtgacttctgcgcatttaa---	CRISPR spacer
agcctgaacaactccggtgacttctgcgc---taaacg	Protospacer
.. **********.***************   ***   

22. spacer 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

--ccagctctgccagtacatctgggacgagttct	CRISPR spacer
cgtcag--cggccagtccatctgggacgaggtca	Protospacer
  .***  * ****** ************* ** 

23. spacer 3.2|3193069|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to MK388859 (Klebsiella phage ST405-OXA48phi1.1, complete genome) position: , mismatch: 7, identity: 0.781

ccggcccgggcgagcttatccatccgtggttc	CRISPR spacer
gcggctcgggcgagcttattcatcctgtgttt	Protospacer
 ****.*************.*****   ***.

24. spacer 3.3|3193129|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to MH518298 (Pseudomonas phage SCYZ1, complete genome) position: , mismatch: 7, identity: 0.781

atagactgccgccttgctcattctcgcgagtg	CRISPR spacer
agcgaatgccgcctttctcattctcgtcattg	Protospacer
*  ** ********* **********. * **

25. spacer 1.11|3169298|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

ccgcgatggacttgagcgcgcagagctgcgtt	CRISPR spacer
gcccgctggatttgagcgcgcagagcaaggtg	Protospacer
 * ** ****.*************** . ** 

26. spacer 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 8, identity: 0.75

ccagctctgccagtacatctgggacgagttct	CRISPR spacer
gccgacgcgccagtacatcttggccgagttct	Protospacer
 * * . .************ ** ********

27. spacer 1.2|3168758|32|NZ_CP009850|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

taccggctggtgacgagctgacccgggatgat	CRISPR spacer
aggtggtcggtgacgcgctgacccgggacgag	Protospacer
 . .**..******* ************.** 

28. spacer 1.3|3168818|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP026333 (Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence) position: , mismatch: 9, identity: 0.719

ttccatgctgttcgtaatatcggtgcggcggc	CRISPR spacer
tcggatactgtccgtaatatcggtgcgtgtga	Protospacer
*.  **.****.***************   * 

29. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to MN693267 (Marine virus AFVG_25M289, complete genome) position: , mismatch: 9, identity: 0.719

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
cctttaatttatctatgtcagctaatgctttg	Protospacer
  ** ***********.*********  .. *

30. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to MN693101 (Marine virus AFVG_25M559, complete genome) position: , mismatch: 9, identity: 0.719

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
cttttaatttatctatgtcagctaatgctttg	Protospacer
  ** ***********.*********  .. *

31. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to NC_042044 (Salmonella phage Melville, complete genome) position: , mismatch: 9, identity: 0.719

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
tattcaatttatctatttcagctaatgtagaa	Protospacer
 .** *********** *********    *.

32. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP038171 (Enterococcus faecium strain SDGJP3 plasmid pSDGJP3, complete sequence) position: , mismatch: 9, identity: 0.719

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
tatgtaatttatttaaatcagctaatcgaaaa	Protospacer
 .*  *******.** ************  *.

33. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP038176 (Enterococcus faecium strain HN11 plasmid pHN11, complete sequence) position: , mismatch: 9, identity: 0.719

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
tatgtaatttatttaaatcagctaatcgaaaa	Protospacer
 .*  *******.** ************  *.

34. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to NZ_MH784601 (Enterococcus faecium strain 25 plasmid pC25-1, complete sequence) position: , mismatch: 9, identity: 0.719

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
tatgtaatttatttaaatcagctaatcgaaaa	Protospacer
 .*  *******.** ************  *.

35. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to NZ_MH784602 (Enterococcus faecium strain 27 plasmid pC27-2, complete sequence) position: , mismatch: 9, identity: 0.719

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
tatgtaatttatttaaatcagctaatcgaaaa	Protospacer
 .*  *******.** ************  *.

36. spacer 1.11|3169298|32|NZ_CP009850|CRISPRCasFinder matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 9, identity: 0.719

ccgcgatggacttgagcgcgcagagctgcgtt	CRISPR spacer
ccgcgatggccttgagctcgcaggccaagtgt	Protospacer
********* ******* *****. * .   *

37. spacer 1.13|3169418|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tggccgactttgtttgtattggcaaacattgt	CRISPR spacer
tggccgacttttttggtattggctttaatgag	Protospacer
*********** ** ********    ** . 

38. spacer 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 9, identity: 0.719

ccagctctgccagtacatctgggacgagttct	CRISPR spacer
ccagctcagccagtacatcggggggtgtcgct	Protospacer
******* *********** ***.  . . **

39. spacer 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 9, identity: 0.719

ccagctctgccagtacatctgggacgagttct	CRISPR spacer
ccagctcagccagtacatcggggggtgtcgct	Protospacer
******* *********** ***.  . . **

40. spacer 2.3|3177587|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 9, identity: 0.719

ccagctctgccagtacatctgggacgagttct	CRISPR spacer
ccagctcagccagtacatcggggggtgtcgct	Protospacer
******* *********** ***.  . . **

41. spacer 2.8|3177889|32|NZ_CP009850|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

tttgagcgtagcggaggcggcgcagcatatag	CRISPR spacer
ctccagcgtggcggcggcggcgcagcagacga	Protospacer
.*. *****.**** ************ *...

42. spacer 4.1|3630230|40|NZ_CP009850|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 9, identity: 0.775

tgtgcggtctgatgccctcaccctggccctctcccacgga	CRISPR spacer
gctaatgcctgatgccctcaccccggccctctcccacagg	Protospacer
  *.  *.***************.*************.*.

43. spacer 1.1|3168698|32|NZ_CP009850|CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 10, identity: 0.688

ctgaacaacttcggtgacttctgcgcatttaa	CRISPR spacer
cgatccaactacgctgacttctgcgcatggtg	Protospacer
* .  ***** ** **************   .

44. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to MN698247 (Pelagibacter phage HTVC115P, complete genome) position: , mismatch: 10, identity: 0.688

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
ctttcaatttttctatatcagctaatgcttta	Protospacer
  ** ***** ***************  .. .

45. spacer 1.5|3168938|32|NZ_CP009850|CRISPRCasFinder matches to AP013455 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C40) position: , mismatch: 11, identity: 0.656

agttgaatttatctatatcagctaatcgccag	CRISPR spacer
cttttaatttttctatatcagctaaagcttta	Protospacer
  ** ***** **************   .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1160120 : 1231038 80 Salmonella_phage(31.91%) plate,head,portal,holin,lysis,tail,tRNA,capsid,integrase,terminase attL 1154789:1154804|attR 1211754:1211769
DBSCAN-SWA_2 1702029 : 1709457 7 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_3 2145816 : 2205552 72 Escherichia_phage(22.5%) plate,portal,head,holin,protease,lysis,tail,capsid,integrase,terminase attL 2143473:2143491|attR 2162288:2162306
DBSCAN-SWA_4 2271748 : 2278677 9 Escherichia_phage(50.0%) tRNA,integrase attL 2259763:2259777|attR 2281793:2281807
DBSCAN-SWA_5 3174087 : 3184125 7 Vibrio_phage(33.33%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP009852
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2253 : 38884 45 Escherichia_phage(33.33%) transposase,protease,integrase attL 1523:1537|attR 39222:39236
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage