Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009881 Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 1 crisprs PD-DExK,RT,csa3 0 5 2 0
NZ_CP009884 Pantoea sp. PSNIH1 plasmid pPSP-ee2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010325 Pantoea sp. PSNIH1 plasmid pPSP-057, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009882 Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP010326 Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009880 Pantoea sp. PSNIH1 chromosome, complete genome 4 crisprs DEDDh,cas3,DinG,PD-DExK,csa3 0 0 8 0

Results visualization

1. NZ_CP009882
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4246 : 63122 52 Escherichia_phage(80.0%) plate,terminase,tail,protease,integrase attL 856:869|attR 26800:26813
DBSCAN-SWA_2 67458 : 84989 28 Escherichia_phage(41.18%) tail NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009881
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 9073 7 Burkholderia_phage(50.0%) transposase,integrase attL 2606:2623|attR 9790:9807
DBSCAN-SWA_2 22119 : 22653 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_3 26670 : 34524 5 Staphylococcus_prophage(25.0%) transposase NA
DBSCAN-SWA_4 46238 : 46679 1 Morganella_phage(100.0%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009880
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009880_1 484999-485095 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009880_2 787843-787956 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009880_3 1321650-1321757 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009880_4 2292237-2292374 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 70089 : 119101 76 Cronobacter_phage(29.09%) integrase,tail,terminase,protease,head,bacteriocin attL 61923:61937|attR 77947:77961
DBSCAN-SWA_2 369959 : 380356 8 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_3 592196 : 726316 149 Erwinia_phage(56.82%) plate,integrase,tail,terminase,portal,coat,head,capsid,tRNA,lysis attL 605017:605033|attR 707233:707249
DBSCAN-SWA_4 1632019 : 1645357 14 Enterobacteria_phage(50.0%) transposase,integrase attL 1628840:1628870|attR 1652038:1652068
DBSCAN-SWA_5 1910186 : 1918901 9 Streptococcus_phage(28.57%) NA NA
DBSCAN-SWA_6 3151809 : 3163155 16 uncultured_Caudovirales_phage(41.67%) lysis NA
DBSCAN-SWA_7 3203220 : 3211638 9 uncultured_Caudovirales_phage(83.33%) NA NA
DBSCAN-SWA_8 3340341 : 3350380 9 Enterobacteria_phage(42.86%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP009883
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009883_1 62845-63080 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 226154-226178 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 62864-62888 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 44641-44665 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 12269-12293 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 170541-170565 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 197617-197641 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 373228-373252 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 106297-106321 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 8037-8061 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 65021-65045 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 199273-199297 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 301740-301764 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 68030-68054 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 222138-222162 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 19207-19231 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 326241-326265 0 1.0
NZ_CP009883_1 1.1|62864|25|NZ_CP009883|CRT 62864-62888 25 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 1902-1926 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 226198-226222 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 62908-62932 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 44597-44621 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 12225-12249 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 170497-170521 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 197661-197685 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 373184-373208 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 106341-106365 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 7993-8017 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 65065-65089 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 199229-199253 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 301696-301720 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 68074-68098 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 222182-222206 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 19251-19275 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 326197-326221 0 1.0
NZ_CP009883_1 1.2|62908|25|NZ_CP009883|CRT 62908-62932 25 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 1946-1970 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 44553-44577 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 12181-12205 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 170453-170477 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 373140-373164 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 7949-7973 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 199185-199209 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 301652-301676 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 326153-326177 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 226242-226266 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 62952-62976 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 197705-197729 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 106385-106409 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 65109-65133 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 68118-68142 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 222226-222250 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 19295-19319 0 1.0
NZ_CP009883_1 1.3|62952|25|NZ_CP009883|CRT 62952-62976 25 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 1990-2014 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 226286-226309 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 62996-63019 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 44510-44533 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 12138-12161 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 170410-170433 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 197749-197772 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 373097-373120 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 106429-106452 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 7906-7929 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 65153-65176 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 199142-199165 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 301609-301632 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 68162-68185 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 222270-222293 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 19339-19362 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 326110-326133 0 1.0
NZ_CP009883_1 1.4|62996|24|NZ_CP009883|CRT 62996-63019 24 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 2034-2057 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 226329-226351 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 63039-63061 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 44468-44490 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 12096-12118 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 KP899803 Salmonella enterica strain 8025 plasmid p8025, complete sequence 170368-170390 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 197792-197814 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 373055-373077 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 7864-7886 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 65196-65218 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 199100-199122 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 301567-301589 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 68205-68227 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 222313-222335 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 KY320277 Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence 19382-19404 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 326068-326090 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_MF072964 Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence 2077-2099 0 1.0
NZ_CP009883_1 1.5|63039|23|NZ_CP009883|CRT 63039-63061 23 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 106472-106494 3 0.87

1. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

2. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

3. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

4. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

5. spacer 1.1|62864|25|NZ_CP009883|CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

6. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

7. spacer 1.1|62864|25|NZ_CP009883|CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

8. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

9. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

10. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

11. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

12. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

13. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

14. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

15. spacer 1.1|62864|25|NZ_CP009883|CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

16. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

17. spacer 1.1|62864|25|NZ_CP009883|CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0 

gaatagtaaaagttgcccttggtcg	CRISPR spacer
gaatagtaaaagttgcccttggtcg	Protospacer
*************************

18. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

19. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

20. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

21. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

22. spacer 1.2|62908|25|NZ_CP009883|CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

23. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

24. spacer 1.2|62908|25|NZ_CP009883|CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

25. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

26. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

27. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

28. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

29. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

30. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

31. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

32. spacer 1.2|62908|25|NZ_CP009883|CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

33. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

34. spacer 1.2|62908|25|NZ_CP009883|CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0 

agcccggaaaaggttcctttggtcg	CRISPR spacer
agcccggaaaaggttcctttggtcg	Protospacer
*************************

35. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

36. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

37. spacer 1.3|62952|25|NZ_CP009883|CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

38. spacer 1.3|62952|25|NZ_CP009883|CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

39. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

40. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

41. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

42. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

43. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

44. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

45. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

46. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

47. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

48. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

49. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

50. spacer 1.3|62952|25|NZ_CP009883|CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

51. spacer 1.3|62952|25|NZ_CP009883|CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0 

ggtttcggatatgtgtctttgctac	CRISPR spacer
ggtttcggatatgtgtctttgctac	Protospacer
*************************

52. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

53. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

54. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

55. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

56. spacer 1.4|62996|24|NZ_CP009883|CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

57. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

58. spacer 1.4|62996|24|NZ_CP009883|CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

59. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

60. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

61. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

62. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

63. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

64. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

65. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

66. spacer 1.4|62996|24|NZ_CP009883|CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

67. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

68. spacer 1.4|62996|24|NZ_CP009883|CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0 

aggctggaaaaggcgcattgtttg	CRISPR spacer
aggctggaaaaggcgcattgtttg	Protospacer
************************

69. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

70. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

71. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

72. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

73. spacer 1.5|63039|23|NZ_CP009883|CRT matches to KP899803 (Salmonella enterica strain 8025 plasmid p8025, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

74. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

75. spacer 1.5|63039|23|NZ_CP009883|CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

76. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

77. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

78. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

79. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

80. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

81. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

82. spacer 1.5|63039|23|NZ_CP009883|CRT matches to KY320277 (Leclercia adecarboxylata strain Lec-476 plasmid pLec-476, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

83. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

84. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_MF072964 (Citrobacter freundii strain P10159 plasmid pP10159-4, complete sequence) position: , mismatch: 0, identity: 1.0 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggctg	Protospacer
***********************

85. spacer 1.5|63039|23|NZ_CP009883|CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 3, identity: 0.87 

gggcgacacacaggatgtggctg	CRISPR spacer
gggcgacacacaggatgtggggc	Protospacer
********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120115 : 159427 44 Escherichia_phage(28.57%) integrase,transposase attL 118413:118427|attR 146894:146908
DBSCAN-SWA_2 208485 : 304554 89 Escherichia_phage(37.93%) integrase,protease,transposase attL 266424:266438|attR 304671:304685

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage