Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018906 Lactobacillus curieae strain CCTCC M 2011381 chromosome, complete genome 4 crisprs csa3,DinG,cas3,DEDDh 0 3 2 0

Results visualization

1. NZ_CP018906
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018906_1 379434-379547 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018906_2 379749-380011 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018906_3 863616-863759 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018906_4 1407760-1407853 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018906_2 2.4|379910|22|NZ_CP018906|CRISPRCasFinder 379910-379931 22 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 174056-174077 1 0.955
NZ_CP018906_1 1.2|379502|22|NZ_CP018906|CRISPRCasFinder 379502-379523 22 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 296392-296413 2 0.909
NZ_CP018906_1 1.2|379502|22|NZ_CP018906|CRISPRCasFinder 379502-379523 22 NZ_CP034470 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence 543480-543501 2 0.909
NZ_CP018906_1 1.2|379502|22|NZ_CP018906|CRISPRCasFinder 379502-379523 22 NZ_CP034475 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence 263276-263297 2 0.909
NZ_CP018906_1 1.2|379502|22|NZ_CP018906|CRISPRCasFinder 379502-379523 22 NZ_CP031650 Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence 151131-151152 2 0.909
NZ_CP018906_2 2.4|379910|22|NZ_CP018906|CRISPRCasFinder 379910-379931 22 MN693498 Marine virus AFVG_25M563, complete genome 29324-29345 2 0.909
NZ_CP018906_2 2.4|379910|22|NZ_CP018906|CRISPRCasFinder 379910-379931 22 MF974398 Leptospira mayottensis 200901116 plasmid p2_L200901116, complete sequence 46153-46174 2 0.909
NZ_CP018906_2 2.4|379910|22|NZ_CP018906|CRISPRCasFinder 379910-379931 22 NZ_CP030149 Leptospira mayottensis strain MDI272 plasmid p_Lmay_MDI272_tenre, complete sequence 3188-3209 2 0.909
NZ_CP018906_2 2.4|379910|22|NZ_CP018906|CRISPRCasFinder 379910-379931 22 NZ_CP030149 Leptospira mayottensis strain MDI272 plasmid p_Lmay_MDI272_tenre, complete sequence 40021-40042 2 0.909
NZ_CP018906_2 2.4|379910|22|NZ_CP018906|CRISPRCasFinder 379910-379931 22 MN036233 Leviviridae sp. isolate H2_Bulk_36_scaffold_25_e_142 hypothetical protein (H2Bulk3625e142_000001) gene, partial cds; and hypothetical protein (H2Bulk3625e142_000002), hypothetical protein (H2Bulk3625e142_000003), and RNA-dependent RNA polymerase (H2Bulk3625e142_000004) genes, complete cds 1152-1173 2 0.909
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1524392-1524416 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1103996-1104020 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 949612-949636 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1722242-1722266 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1030422-1030446 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1174080-1174104 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1760961-1760985 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1188997-1189021 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1361492-1361516 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 707511-707535 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1497403-1497427 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1106528-1106552 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1545111-1545135 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1411314-1411338 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1181831-1181855 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1290794-1290818 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 896686-896710 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1109707-1109731 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1106413-1106437 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1069435-1069459 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP032696 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence 291246-291270 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1918609-1918633 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1077269-1077293 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 882994-883018 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1181820-1181844 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1069402-1069426 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1164466-1164490 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1192074-1192098 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1069403-1069427 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1085983-1086007 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1164466-1164490 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1192074-1192098 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1069416-1069440 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1164466-1164490 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1086006-1086030 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1164470-1164494 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1192074-1192098 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1192074-1192098 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1192074-1192098 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1069416-1069440 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 862169-862193 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1069405-1069429 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1086006-1086030 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1104622-1104646 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1085289-1085313 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1132956-1132980 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1179400-1179424 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 993093-993117 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1069405-1069429 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1086006-1086030 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1164465-1164489 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 534094-534118 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1069401-1069425 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1086006-1086030 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1086006-1086030 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1069416-1069440 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1192075-1192099 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 852934-852958 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1069427-1069451 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1069405-1069429 5 0.8
NZ_CP018906_2 2.1|379772|25|NZ_CP018906|CRISPRCasFinder 379772-379796 25 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 852934-852958 5 0.8

1. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 1, identity: 0.955

ggcagcttttgcagcatttgca	CRISPR spacer
ggcagcttttgcagcttttgca	Protospacer
*************** ******

2. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

agccgacgttgcggcagctgac	CRISPR spacer
tgccgacgttgcagcagctgac	Protospacer
 ***********.*********

3. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 2, identity: 0.909

agccgacgttgcggcagctgac	CRISPR spacer
tgccgacgttgcagcagctgac	Protospacer
 ***********.*********

4. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 2, identity: 0.909

agccgacgttgcggcagctgac	CRISPR spacer
tgccgacgttgcagcagctgac	Protospacer
 ***********.*********

5. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

agccgacgttgcggcagctgac	CRISPR spacer
tgccgacgttgcagcagctgac	Protospacer
 ***********.*********

6. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to MN693498 (Marine virus AFVG_25M563, complete genome) position: , mismatch: 2, identity: 0.909

ggcagcttttgcagcatttgca	CRISPR spacer
agcagcatttgcagcatttgca	Protospacer
.***** ***************

7. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to MF974398 (Leptospira mayottensis 200901116 plasmid p2_L200901116, complete sequence) position: , mismatch: 2, identity: 0.909

ggcagcttttgcagcatttgca	CRISPR spacer
agcagcttttgcagcattggca	Protospacer
.***************** ***

8. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP030149 (Leptospira mayottensis strain MDI272 plasmid p_Lmay_MDI272_tenre, complete sequence) position: , mismatch: 2, identity: 0.909

ggcagcttttgcagcatttgca	CRISPR spacer
agcagcttttgcagcattggca	Protospacer
.***************** ***

9. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP030149 (Leptospira mayottensis strain MDI272 plasmid p_Lmay_MDI272_tenre, complete sequence) position: , mismatch: 2, identity: 0.909

ggcagcttttgcagcatttgca	CRISPR spacer
agcagcttttgcagcattggca	Protospacer
.***************** ***

10. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to MN036233 (Leviviridae sp. isolate H2_Bulk_36_scaffold_25_e_142 hypothetical protein (H2Bulk3625e142_000001) gene, partial cds; and hypothetical protein (H2Bulk3625e142_000002), hypothetical protein (H2Bulk3625e142_000003), and RNA-dependent RNA polymerase (H2Bulk3625e142_000004) genes, complete cds) position: , mismatch: 2, identity: 0.909

ggcagcttttgcagcatttgca	CRISPR spacer
ggcagcatttgcagcatttgcc	Protospacer
****** ************** 

11. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

12. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

13. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

14. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

15. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

16. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

17. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

18. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

19. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

20. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

21. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

22. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

23. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

24. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

25. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

26. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

27. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

28. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

29. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

30. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

31. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
catgccggcagcaattgctgcactg	Protospacer
 .*  *******************.

32. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

33. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

34. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

35. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

36. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

37. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

38. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

39. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

40. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

41. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

42. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

43. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

44. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

45. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

46. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

47. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

48. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

49. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

50. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

51. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

52. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

53. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

54. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

55. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

56. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

57. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

58. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

59. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

60. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

61. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

62. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

63. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

64. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

65. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

66. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

67. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

68. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

69. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

70. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

71. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8

agttgcggcagcaattgctgcacta	CRISPR spacer
aggtgcggcagcaattgctgctgcg	Protospacer
** ******************  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 697588 : 706123 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1901601 : 1909794 8 Staphylococcus_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage