1. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 1, identity: 0.955
ggcagcttttgcagcatttgca CRISPR spacer
ggcagcttttgcagcttttgca Protospacer
*************** ******
2. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
agccgacgttgcggcagctgac CRISPR spacer
tgccgacgttgcagcagctgac Protospacer
***********.*********
3. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP034470 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_1, complete sequence) position: , mismatch: 2, identity: 0.909
agccgacgttgcggcagctgac CRISPR spacer
tgccgacgttgcagcagctgac Protospacer
***********.*********
4. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP034475 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_1, complete sequence) position: , mismatch: 2, identity: 0.909
agccgacgttgcggcagctgac CRISPR spacer
tgccgacgttgcagcagctgac Protospacer
***********.*********
5. spacer 1.2|379502|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP031650 (Pantoea agglomerans strain TH81 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
agccgacgttgcggcagctgac CRISPR spacer
tgccgacgttgcagcagctgac Protospacer
***********.*********
6. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to MN693498 (Marine virus AFVG_25M563, complete genome) position: , mismatch: 2, identity: 0.909
ggcagcttttgcagcatttgca CRISPR spacer
agcagcatttgcagcatttgca Protospacer
.***** ***************
7. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to MF974398 (Leptospira mayottensis 200901116 plasmid p2_L200901116, complete sequence) position: , mismatch: 2, identity: 0.909
ggcagcttttgcagcatttgca CRISPR spacer
agcagcttttgcagcattggca Protospacer
.***************** ***
8. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP030149 (Leptospira mayottensis strain MDI272 plasmid p_Lmay_MDI272_tenre, complete sequence) position: , mismatch: 2, identity: 0.909
ggcagcttttgcagcatttgca CRISPR spacer
agcagcttttgcagcattggca Protospacer
.***************** ***
9. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to NZ_CP030149 (Leptospira mayottensis strain MDI272 plasmid p_Lmay_MDI272_tenre, complete sequence) position: , mismatch: 2, identity: 0.909
ggcagcttttgcagcatttgca CRISPR spacer
agcagcttttgcagcattggca Protospacer
.***************** ***
10. spacer 2.4|379910|22|NZ_CP018906|CRISPRCasFinder matches to MN036233 (Leviviridae sp. isolate H2_Bulk_36_scaffold_25_e_142 hypothetical protein (H2Bulk3625e142_000001) gene, partial cds; and hypothetical protein (H2Bulk3625e142_000002), hypothetical protein (H2Bulk3625e142_000003), and RNA-dependent RNA polymerase (H2Bulk3625e142_000004) genes, complete cds) position: , mismatch: 2, identity: 0.909
ggcagcttttgcagcatttgca CRISPR spacer
ggcagcatttgcagcatttgcc Protospacer
****** **************
11. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
12. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
13. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
14. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
15. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
16. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
17. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
18. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
19. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
20. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
21. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
22. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
23. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
24. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
25. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
26. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
27. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
28. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
29. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
30. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
31. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
catgccggcagcaattgctgcactg Protospacer
.* *******************.
32. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
33. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
34. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
35. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
36. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
37. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
38. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
39. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
40. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
41. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
42. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
43. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
44. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
45. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
46. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
47. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
48. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
49. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
50. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
51. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
52. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
53. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
54. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
55. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
56. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
57. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
58. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
59. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
60. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
61. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
62. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
63. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
64. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
65. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
66. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
67. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
68. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
69. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
70. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..
71. spacer 2.1|379772|25|NZ_CP018906|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8
agttgcggcagcaattgctgcacta CRISPR spacer
aggtgcggcagcaattgctgctgcg Protospacer
** ****************** ..