Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009913 Streptococcus salivarius strain NCTC 8618 chromosome, complete genome 3 crisprs DEDDh,csa3,DinG,WYL,cas3 0 1 5 0

Results visualization

1. NZ_CP009913
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009913_1 269943-270036 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009913_2 685425-685527 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009913_3 1574033-1574139 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009913_2 2.1|685448|57|NZ_CP009913|CRISPRCasFinder 685448-685504 57 MK448979 Streptococcus phage Javan534, complete genome 13372-13428 0 1.0
NZ_CP009913_2 2.1|685448|57|NZ_CP009913|CRISPRCasFinder 685448-685504 57 MK448799 Streptococcus phage Javan535, complete genome 13372-13428 0 1.0
NZ_CP009913_2 2.1|685448|57|NZ_CP009913|CRISPRCasFinder 685448-685504 57 MK448800 Streptococcus phage Javan539, complete genome 13373-13429 0 1.0

1. spacer 2.1|685448|57|NZ_CP009913|CRISPRCasFinder matches to MK448979 (Streptococcus phage Javan534, complete genome) position: , mismatch: 0, identity: 1.0

tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	CRISPR spacer
tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	Protospacer
*********************************************************

2. spacer 2.1|685448|57|NZ_CP009913|CRISPRCasFinder matches to MK448799 (Streptococcus phage Javan535, complete genome) position: , mismatch: 0, identity: 1.0

tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	CRISPR spacer
tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	Protospacer
*********************************************************

3. spacer 2.1|685448|57|NZ_CP009913|CRISPRCasFinder matches to MK448800 (Streptococcus phage Javan539, complete genome) position: , mismatch: 0, identity: 1.0

tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	CRISPR spacer
tccctgagggacaaacccgagaatgtccctgtgtccctgaggtgtctctagggacaa	Protospacer
*********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 386731 : 392213 6 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 668896 : 744455 85 Streptococcus_phage(77.97%) holin,portal,protease,tail,terminase,integrase,capsid attL 671975:672018|attR 712907:712950
DBSCAN-SWA_3 1216596 : 1227261 11 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_4 1993650 : 2040658 45 Lactococcus_phage(25.0%) transposase,bacteriocin,tRNA,protease NA
DBSCAN-SWA_5 2166514 : 2177945 12 Staphylococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage