1. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 6.15|1574667|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 6.15|1574667|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 6.15|1574667|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 6.15|1574667|22|NZ_HG813240|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 2.2|333163|21|NZ_HG813240|PILER-CR matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 2, identity: 0.905
gtcacgctggcgccgccgtca CRISPR spacer
ctcacgctggcgccgccgtcc Protospacer
*******************
9. spacer 6.2|1573740|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 6.2|1573740|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 6.2|1573740|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 6.2|1573740|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 6.2|1573740|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
14. spacer 6.3|1573794|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
15. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
16. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
18. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
19. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
24. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
25. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
26. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
27. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
28. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
30. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
31. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
32. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
33. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
34. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
35. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
36. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
37. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
38. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
41. spacer 1.11|332485|27|NZ_HG813240|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
42. spacer 1.11|332485|27|NZ_HG813240|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
43. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
44. spacer 6.4|1573848|22|NZ_HG813240|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
45. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
46. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
47. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
48. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
49. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
50. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
51. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
52. spacer 6.15|1574667|22|NZ_HG813240|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
53. spacer 8.5|2072254|24|NZ_HG813240|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
54. spacer 8.5|2072254|24|NZ_HG813240|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
55. spacer 3.1|364915|27|NZ_HG813240|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
56. spacer 3.1|364915|27|NZ_HG813240|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
57. spacer 3.7|365311|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
58. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
59. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
60. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
61. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
62. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
63. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
64. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
65. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
66. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
67. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
68. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
69. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
70. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
71. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
72. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
73. spacer 6.14|1574610|25|NZ_HG813240|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
74. spacer 8.5|2072254|24|NZ_HG813240|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
75. spacer 8.5|2072254|24|NZ_HG813240|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
76. spacer 8.5|2072254|24|NZ_HG813240|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
77. spacer 1.2|332005|27|NZ_HG813240|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
78. spacer 1.11|332485|27|NZ_HG813240|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
79. spacer 1.11|332485|27|NZ_HG813240|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
80. spacer 1.11|332485|27|NZ_HG813240|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
81. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
82. spacer 1.12|332530|30|NZ_HG813240|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
83. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
84. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
85. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
86. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
87. spacer 3.1|364915|27|NZ_HG813240|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
88. spacer 3.1|364915|27|NZ_HG813240|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
89. spacer 3.7|365311|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
90. spacer 3.7|365311|27|NZ_HG813240|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
91. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
92. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
93. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
94. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
95. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
96. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
97. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
98. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
99. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
100. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
101. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
102. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
103. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
104. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
105. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
106. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
107. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
108. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
109. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
110. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
111. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
112. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
113. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
114. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
115. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
116. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
117. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
118. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
119. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
120. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
121. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
122. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
123. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
124. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
125. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
126. spacer 6.5|1573902|25|NZ_HG813240|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
127. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
128. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
129. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
130. spacer 6.13|1574544|34|NZ_HG813240|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
131. spacer 1.3|332050|30|NZ_HG813240|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
132. spacer 1.12|332530|30|NZ_HG813240|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
133. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
134. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
135. spacer 3.1|364915|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
136. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
137. spacer 3.7|365311|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
138. spacer 3.9|365461|27|NZ_HG813240|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
139. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
140. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
141. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
142. spacer 3.10|365521|27|NZ_HG813240|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
143. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
144. spacer 4.2|629740|30|NZ_HG813240|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
145. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
146. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
147. spacer 4.2|629740|30|NZ_HG813240|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
148. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
149. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
150. spacer 4.2|629740|30|NZ_HG813240|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
151. spacer 4.2|629740|30|NZ_HG813240|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
152. spacer 4.2|629740|30|NZ_HG813240|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
153. spacer 4.2|629740|30|NZ_HG813240|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
154. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
155. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
156. spacer 4.2|629740|30|NZ_HG813240|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
157. spacer 4.2|629740|30|NZ_HG813240|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
158. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
159. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
160. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
161. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
162. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
163. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
164. spacer 6.13|1574544|34|NZ_HG813240|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
165. spacer 1.3|332050|30|NZ_HG813240|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
166. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
167. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
168. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
169. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
170. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
171. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
172. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
173. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
174. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
175. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
176. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
177. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
178. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
179. spacer 3.4|365110|27|NZ_HG813240|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
180. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
181. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
182. spacer 4.2|629740|30|NZ_HG813240|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
183. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
184. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
185. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
186. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
187. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
188. spacer 4.2|629740|30|NZ_HG813240|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
189. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
190. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
191. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
192. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
193. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
194. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
195. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
196. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
197. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
198. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
199. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
200. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
201. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
202. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
203. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
204. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
205. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
206. spacer 6.1|1573680|28|NZ_HG813240|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
207. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
208. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
209. spacer 8.3|2072164|30|NZ_HG813240|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
210. spacer 8.3|2072164|30|NZ_HG813240|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
211. spacer 8.3|2072164|30|NZ_HG813240|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
212. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttgagatccgcgacgatgggtgtggcgccggc Protospacer
** .********.**** ***********
213. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ttcccgcaggcgacggtgcgggcggcgccggc Protospacer
**..* * ********* ***.*********
214. spacer 1.3|332050|30|NZ_HG813240|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
215. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
216. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
217. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
218. spacer 1.12|332530|30|NZ_HG813240|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
219. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
220. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
221. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
222. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
223. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
224. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
225. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
226. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
227. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
228. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
229. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
230. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
231. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
232. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
233. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
234. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
235. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
236. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
237. spacer 8.3|2072164|30|NZ_HG813240|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
238. spacer 8.3|2072164|30|NZ_HG813240|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
239. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agcgcggccgcgtcggtgggggtggcgcccgc Protospacer
. * ***** **************** **
240. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 8, identity: 0.75
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcaccaccgcggcggtgcgggtggcgccggc Protospacer
. . *. *****.***** *************
241. spacer 1.13|332578|39|NZ_HG813240|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
242. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
243. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
244. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
245. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
246. spacer 4.2|629740|30|NZ_HG813240|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
247. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
248. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
249. spacer 5.1|690447|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
250. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
251. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
252. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
253. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
254. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
255. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
256. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
257. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
258. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
259. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
260. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcccccggcgtgacggtggaggtggcgccggc Protospacer
...*. **.********.************
261. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
agaccgcccgcgatggagggggtggcgccgag Protospacer
.* *******.** *************.
262. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
263. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cccaccgcggcgacgggggcggtggcgccggc Protospacer
... *. * ******* ** ************
264. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gtggcggtggcggcggtgggggtggcggcggc Protospacer
* * . ***.************** ****
265. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tgcgaccgggcgacggtggaggtggcgccagc Protospacer
* . .* **********.*********.**
266. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
caacattcagcgacggtgggtgtggcggcggc Protospacer
. . *.* *********** ****** ****
267. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 9, identity: 0.719
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcacgacggcggcggtgcgggtggcgccggc Protospacer
. . * * ***.***** *************
268. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
269. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
270. spacer 3.6|365245|33|NZ_HG813240|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
271. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
272. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
273. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
274. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
275. spacer 6.10|1574295|31|NZ_HG813240|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
276. spacer 6.13|1574544|34|NZ_HG813240|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
277. spacer 11.9|3114060|35|NZ_HG813240|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
278. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
aggacggccgcggcggtggcggtggcgccgta Protospacer
* *****.****** **********
279. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
ctgctggccgcgacggtgctggtggcgccgat Protospacer
.* .. *********** **********..
280. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
tcgcggatcgggatggtgggggtggcgccgga Protospacer
*. . .** **.*****************
281. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
gcgagggcggcgacggtgggcgtgtcgccggc Protospacer
. * *********** *** *******
282. spacer 13.6|3738357|32|NZ_HG813240|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656
ttttctcccgcgacggtgggggtggcgccggc CRISPR spacer
cgcagcagcgcgacggtgtcggtggcgccggt Protospacer
. . . ********** ***********.