Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP003408 Thermotoga sp. 2812B, complete genome 8 crisprs DEDDh,cas14k,WYL,cas3,cas3HD,cas6,csx1,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csx22,cas8b1,cas7,cas5,cas4,cas1,cas2,cmr1gr7,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,csa3 0 3 4 0

Results visualization

1. NZ_CP003408
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_1 557128-558291 Orphan III-A
17 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_2 570459-571677 Orphan III-A
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_3 599826-601733 Orphan III-A
28 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_4 978646-978734 Orphan III-A
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_5 1065059-1066017 TypeIII III-A
14 spacers
csx22,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas8b1,cas7,cas5,cas4,cas1,cas2,cmr1gr7,cmr3gr5,cmr4gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_6 1205998-1207638 Orphan III-A
24 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_7 1320374-1321606 Orphan III-A
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP003408_8 1412394-1413630 Orphan III-A
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP003408_6 6.16|1207036|36|NZ_CP003408|PILER-CR,CRISPRCasFinder,CRT 1207036-1207071 36 MK814759 Gordonia phage Reyja, complete genome 9095-9130 8 0.778
NZ_CP003408_5 5.2|1065155|37|NZ_CP003408|PILER-CR,CRISPRCasFinder,CRT 1065155-1065191 37 NC_002575 Agrobacterium rhizogenes plasmid pRi1724 DNA, complete sequence 92280-92316 9 0.757
NZ_CP003408_5 5.2|1065155|37|NZ_CP003408|PILER-CR,CRISPRCasFinder,CRT 1065155-1065191 37 NZ_KY000038 Agrobacterium rhizogenes strain 1724 plasmid pRi_1724, complete sequence 139600-139636 9 0.757
NZ_CP003408_5 5.12|1065821|37|NZ_CP003408|CRISPRCasFinder,CRT 1065821-1065857 37 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 996115-996151 9 0.757
NZ_CP003408_5 5.12|1065821|37|NZ_CP003408|CRISPRCasFinder,CRT 1065821-1065857 37 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 115273-115309 10 0.73

1. spacer 6.16|1207036|36|NZ_CP003408|PILER-CR,CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.778

acaacaacctcgacaccgacgactacaggcttgacg---	CRISPR spacer
acatcaacctcgacgccgacgactac---tccgacgggt	Protospacer
*** **********.***********   ...****   

2. spacer 5.2|1065155|37|NZ_CP003408|PILER-CR,CRISPRCasFinder,CRT matches to NC_002575 (Agrobacterium rhizogenes plasmid pRi1724 DNA, complete sequence) position: , mismatch: 9, identity: 0.757

tagccgacgacgtcgagatccccaacaactcgtactc-	CRISPR spacer
acgccgccgacgtcgagatcctcaacaa-gcatatccg	Protospacer
  **** **************.******  *.**..* 

3. spacer 5.2|1065155|37|NZ_CP003408|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000038 (Agrobacterium rhizogenes strain 1724 plasmid pRi_1724, complete sequence) position: , mismatch: 9, identity: 0.757

tagccgacgacgtcgagatccccaacaactcgtactc-	CRISPR spacer
acgccgccgacgtcgagatcctcaacaa-gcatatccg	Protospacer
  **** **************.******  *.**..* 

4. spacer 5.12|1065821|37|NZ_CP003408|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.757

gcgcccgccagcgccagcgccagcatgccaaaaacaa-	CRISPR spacer
ccgcgcgccagcgccagcgccaccatg-cagacgcggt	Protospacer
 *** ***************** **** **.* .*.. 

5. spacer 5.12|1065821|37|NZ_CP003408|CRISPRCasFinder,CRT matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 10, identity: 0.73

gcgcccgccagcgccagcgccagcatgccaaaaacaa	CRISPR spacer
accaccgccagcgccagcgccggcatggcaagatgcg	Protospacer
.*  *****************.***** ***.*   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1038980 : 1046923 10 Staphylococcus_phage(37.5%) protease,transposase NA
DBSCAN-SWA_2 1187012 : 1194625 10 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 1525062 : 1542980 16 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_4 1680413 : 1689132 9 Powai_lake_megavirus(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage