Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010075 Bacillus sp. WP8 chromosome, complete genome 1 crisprs WYL,DEDDh,csa3,DinG,cas3 2 1 9 2

Results visualization

1. NZ_CP010075
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010075_1 2759740-2759949 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP010075_1 1.2|2759830|18|NZ_CP010075|CRT 2759830-2759847 18 NZ_CP010075.1 1132740-1132757 1 0.944
NZ_CP010075_1 1.2|2759830|18|NZ_CP010075|CRT 2759830-2759847 18 NZ_CP010075.1 2759734-2759751 1 0.944
NZ_CP010075_1 1.4|2759914|18|NZ_CP010075|CRT 2759914-2759931 18 NZ_CP010075.1 2759734-2759751 1 0.944

1. spacer 1.2|2759830|18|NZ_CP010075|CRT matches to position: 1132740-1132757, mismatch: 1, identity: 0.944

tggcactgtcgttggcgc	CRISPR spacer
tggaactgtcgttggcgc	Protospacer
*** **************

2. spacer 1.2|2759830|18|NZ_CP010075|CRT matches to position: 2759734-2759751, mismatch: 1, identity: 0.944

tggcactgtcgttggcgc	CRISPR spacer
tggcactgttgttggcgc	Protospacer
*********.********

3. spacer 1.4|2759914|18|NZ_CP010075|CRT matches to position: 2759734-2759751, mismatch: 1, identity: 0.944

tggcgctgttgttggcgc	CRISPR spacer
tggcactgttgttggcgc	Protospacer
****.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010075_1 1.3|2759866|30|NZ_CP010075|CRT 2759866-2759895 30 MG592515 Vibrio phage 1.144.O._10N.286.45.B3, partial genome 8436-8465 7 0.767
NZ_CP010075_1 1.3|2759866|30|NZ_CP010075|CRT 2759866-2759895 30 MK765592 Tortoise microvirus 41 isolate 41_SP_100, complete genome 3276-3305 8 0.733
NZ_CP010075_1 1.3|2759866|30|NZ_CP010075|CRT 2759866-2759895 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1652512-1652541 8 0.733

1. spacer 1.3|2759866|30|NZ_CP010075|CRT matches to MG592515 (Vibrio phage 1.144.O._10N.286.45.B3, partial genome) position: , mismatch: 7, identity: 0.767

tggcgctgttgttggcactgtcgttggcac	CRISPR spacer
cggcgctgttgttggtactggcgttttttc	Protospacer
.**************.**** ****  . *

2. spacer 1.3|2759866|30|NZ_CP010075|CRT matches to MK765592 (Tortoise microvirus 41 isolate 41_SP_100, complete genome) position: , mismatch: 8, identity: 0.733

tggcgctgttgttggcactgtcgttggcac	CRISPR spacer
gcccgctgttgttggcgctgtcgctggtct	Protospacer
   *************.******.***. .

3. spacer 1.3|2759866|30|NZ_CP010075|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 8, identity: 0.733

tggcgctgttgttggcactgtcgttggcac	CRISPR spacer
ccgacatggtgttggcactgtcggtggcaa	Protospacer
. *   ** ************** ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22313 : 31037 8 uncultured_Mediterranean_phage(16.67%) tRNA NA
DBSCAN-SWA_2 661644 : 671540 9 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 1166150 : 1194863 31 Bacillus_phage(28.57%) coat,transposase NA
DBSCAN-SWA_4 1694123 : 1700384 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 2051442 : 2059153 10 Ostreococcus_lucimarinus_virus(16.67%) NA NA
DBSCAN-SWA_6 2097262 : 2103650 10 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_7 2747841 : 2773843 37 Bacillus_phage(28.0%) holin,terminase,capsid,portal,tail,plate NA
DBSCAN-SWA_8 3083043 : 3092060 10 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_9 3360461 : 3406718 53 Escherichia_phage(28.57%) coat,transposase,protease NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP010075.1|WP_039181017.1|2772224_2772626_-|hypothetical-protein 2772224_2772626_- 133 aa aa NA NA NA 2747841-2773843 yes
NZ_CP010075.1|WP_144246071.1|2772676_2772916_-|hypothetical-protein 2772676_2772916_- 79 aa aa NA NA NA 2747841-2773843 yes