1. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 2, identity: 0.929
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaagggcggcggcggc Protospacer
*************** ***********.
2. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 2, identity: 0.929
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtcctgaccggcggcggcggt Protospacer
********* **** *************
3. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgatcggcggcgacggc Protospacer
************** ********.***.
4. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
5. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
6. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaacggcggtgccggc Protospacer
*********************.* ***.
7. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggg Protospacer
*******..******************
8. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gaacgacgtgctggacggcgacggcggt Protospacer
************.******.*******
9. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
10. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggg Protospacer
*******..******************
11. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggg Protospacer
*******..******************
12. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggg Protospacer
*******..******************
13. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
14. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
15. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
16. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
17. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
18. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
19. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgacaggcggcggcggg Protospacer
************** ***********
20. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
21. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
22. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
23. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
24. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
25. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
26. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
27. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
28. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
29. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
30. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
31. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
32. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
33. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
34. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
35. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
36. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
37. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
38. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggc Protospacer
*******..******************.
39. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggg Protospacer
*******..******************
40. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
41. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
42. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
43. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
44. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
45. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
46. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggc Protospacer
*******..******************.
47. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggc Protospacer
*******..******************.
48. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
49. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
50. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
51. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
52. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
53. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
54. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
55. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
56. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
57. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
58. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
59. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
60. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
61. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
62. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
63. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
64. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
65. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
66. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
67. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggg Protospacer
*******..******************
68. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
69. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
70. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggg Protospacer
*******..******************
71. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
72. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
73. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
74. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcggc Protospacer
*******..******************.
75. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacaacgtcctgaacggcggcggcggc Protospacer
****.**** *****************.
76. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacaacgtcctgaacggcggcggcggc Protospacer
****.**** *****************.
77. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
78. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
79. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
80. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
81. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.893
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctcaacggcggcgacggc Protospacer
************ **********.***.
82. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacggcgtgctgatcggcggcggcggg Protospacer
*.***.******** ************
83. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgacgacgtgctgatcggcggcgccggt Protospacer
..************ ******** ****
84. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gaacgacgagctgaacggcggcgacggc Protospacer
******* **************.***.
85. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
aaacgacgtgctcgacggcggcggcggg Protospacer
*********** .*************
86. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtgctgaacggcggagacggg Protospacer
*.******************* *.***
87. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgatgtgctgaagggcggcggcggc Protospacer
*.****.******** ***********.
88. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacacgctgaacggcggcggcggg Protospacer
*.*****..******************
89. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtcctgaacggcggcgacggc Protospacer
*.******* *************.***.
90. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacggcgtgctgatcggcggcggcggg Protospacer
*.***.******** ************
91. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtcctgaacggcggcgacggc Protospacer
*.******* *************.***.
92. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtcctgaacggcggcgacggc Protospacer
*.******* *************.***.
93. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaccggcggcaagggt Protospacer
************** *******.. ***
94. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtgctgatcggcggccgcggc Protospacer
*.************ ******* ****.
95. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgatgtgctgaacggcggcgcgggc Protospacer
******.**************** **.
96. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtcctgaacggcggcgacggc Protospacer
*.******* *************.***.
97. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtgctgatcggcggccgcggc Protospacer
*.************ ******* ****.
98. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ccatgacgtgctgaacggcggcagcggc Protospacer
* *.******************.****.
99. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacggcgtgctgatcggcggcggcggg Protospacer
*.***.******** ************
100. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtcctgaacggcggcgacggc Protospacer
*.******* *************.***.
101. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtcctgaacggcggcgacggc Protospacer
*.******* *************.***.
102. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cagtgacgtgctgcgcggcggcggcggt Protospacer
**..********* .*************
103. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_049489 (Arthrobacter phage DrYang, complete genome) position: , mismatch: 4, identity: 0.857
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ccacgacgggcagaacggcggcggcgtt Protospacer
* ****** ** ************** *
104. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
105. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
106. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
107. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcggggcgggc Protospacer
******* ************* * **.
108. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
109. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
110. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
111. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
112. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
113. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
114. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
115. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
116. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
117. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
118. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
119. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
120. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
121. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
122. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
123. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
124. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
125. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
126. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
127. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
128. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
129. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
130. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
131. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
132. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
133. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
134. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
135. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
136. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
137. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
138. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
139. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
140. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
141. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
142. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
143. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
144. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
145. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
146. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
147. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
148. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
149. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
150. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
151. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
152. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
153. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
154. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
155. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
156. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
157. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
158. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
159. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
160. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
161. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
162. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
163. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
164. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
165. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
166. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
167. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
168. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
169. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
170. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
171. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
172. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
173. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
174. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
175. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
176. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
177. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
178. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
179. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctggacggcggcaatggc Protospacer
*************.********...**.
180. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
181. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
182. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
183. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctggacggcggcaatggc Protospacer
*************.********...**.
184. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
185. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctggacggcggcaatggc Protospacer
*************.********...**.
186. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
187. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
188. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
189. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
190. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
191. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgacgacgtgctgatcggcggcgccggc Protospacer
..************ ******** ***.
192. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
193. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
194. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
195. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
196. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
197. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcggcggc Protospacer
.. **********.*************.
198. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
199. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
200. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
201. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cagcgacgtgctgtacggcggcgatggc Protospacer
**.********** *********..**.
202. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
203. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
204. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
205. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ccgcgacgtgctgaccggcggcggcgag Protospacer
* .*********** ***********.
206. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacaacgtgctcaacggcggcgcgggc Protospacer
****.******* ********** **.
207. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP040722 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gcacgacgttctgaacggcgtcggcggc Protospacer
******* ********** ******.
208. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
209. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
210. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
211. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgacgacgtgctgatcggcggcgccggg Protospacer
..************ ******** ***
212. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cggcgacgtgctggacggcggcgacggc Protospacer
*..**********.*********.***.
213. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
214. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
215. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
216. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
217. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
218. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
219. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
220. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
221. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
222. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
223. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
224. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaacggcgattccggc Protospacer
********************.. ***.
225. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
226. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to KR080198 (Mycobacterium phage Cambiare, complete genome) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ggacgtcgtgctgatcggcggcggcggc Protospacer
.*** ******** ************.
227. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP034347 (Roseovarius sp. MME-070 plasmid pMME07001, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ccatgacgtgctggacggcggcgccggg Protospacer
* *.*********.********* ***
228. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
229. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gcacgacgtgctgtacggcgccggcggc Protospacer
*********** ****** ******.
230. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gcacgacgtgctgtacggcgccggcggc Protospacer
*********** ****** ******.
231. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggg Protospacer
************ ** *********
232. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgctcggcggcgatggc Protospacer
************* ********..**.
233. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP036421 (Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcgggcccggg Protospacer
******* ************* ***
234. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
235. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
236. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtacgacgtgctgatcgtcggcggcggc Protospacer
************ ** *********.
237. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gaacgacctggtgaacggcggcggcgac Protospacer
****** ** ***************..
238. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacacgctgaacggcggcggcttg Protospacer
*******..****************
239. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaccggcggcaatggc Protospacer
************** *******...**.
240. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gaccgacctgctgaacggcggcgccggc Protospacer
* **** *************** ***.
241. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaccggcggcaatggc Protospacer
************** *******...**.
242. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cggcgacgtgctgaccggcggcgacggc Protospacer
*..*********** ********.***.
243. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgacgacgtgctgatcggcggcgatggc Protospacer
*.************ ********..**.
244. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to KR080206 (Mycobacterium phage ShedlockHolmes, complete genome) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ttacggcgtgctgaacagcggcggcgtt Protospacer
. ***.**********.********* *
245. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaccggcggcaatggc Protospacer
************** *******...**.
246. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaccggcggcaatggc Protospacer
************** *******...**.
247. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaccggcggcaatggc Protospacer
************** *******...**.
248. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcggggcgggc Protospacer
******* ************* * **.
249. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgtcgtgctgatcggcggcgcaggc Protospacer
***** ******** ******** **.
250. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ccaggacgtgctgaccggcggcgacggc Protospacer
* * ********** ********.***.
251. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgaacggcggggcgggc Protospacer
******* ************* * **.
252. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.821
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacctgctgatcggcggcgatggc Protospacer
******* ****** ********..**.
253. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtcctgaacggcggatcgggc Protospacer
********* *********** **.
254. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
aaacgacgtcctgatcggcggcggggcc Protospacer
******** **** ********* * .
255. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcgccggc Protospacer
.. **********.********* ***.
256. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP035421 (Leisingera sp. NJS204 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgctgacgtgctgaccggcggcgccggc Protospacer
*. .********** ******** ***.
257. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgccgacgtgctggacggcggcgccggc Protospacer
.. **********.********* ***.
258. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctggacggcggaacgggg Protospacer
*************.******* . **
259. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
aaacgacgtgctgaccggcggcaagggc Protospacer
************* *******.. **.
260. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tggcgacgtcatgaacggcggcggcggc Protospacer
...****** ****************.
261. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tcacgacgtactgcacggcggcggcgtg Protospacer
. *******.*** ************
262. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgagcgcgtgctgaacggccgcggcggg Protospacer
*.* .************* *******
263. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gcgcgacgtgctgaccggcggcgacggg Protospacer
.*********** ********.***
264. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gaaccacgtgctgaacggcggcgaggcg Protospacer
*** ******************. *
265. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
aggcggcgtgctgatcggcggcggcgat Protospacer
..**.******** ***********.*
266. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP035420 (Leisingera sp. NJS204 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctggaaggcggcgcccag Protospacer
*************.* ******* * .
267. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_KJ599675 (Micrococcus sp. A7 plasmid pLMA7, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gatggacgtgctgagcggcggcggccgc Protospacer
* **********.********** *.
268. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctggaaggcggcgcccag Protospacer
*************.* ******* * .
269. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP021185 (Sphingomonas wittichii DC-6 plasmid pDC04, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
aggcggcgtgctgatcggcggcggcgat Protospacer
..**.******** ***********.*
270. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_AP018666 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_3, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
aggcggcgtgctgatcggcggcggcgat Protospacer
..**.******** ***********.*
271. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tgacgatgtgctgaacggcggcgcgggc Protospacer
..****.**************** **.
272. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
aggcggcgtgctgatcggcggcggcgat Protospacer
..**.******** ***********.*
273. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP034329 (Tabrizicola piscis strain K13M18 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gatggtggtgctgaccggcggcggcggt Protospacer
* * ******* *************
274. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP017887 (Pseudomonas frederiksbergensis strain ERDD5:01 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
caacgacgtgctgaactggggcgctaat Protospacer
**************** * **** ...*
275. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 6, identity: 0.786
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gaccgacgtgctcaacagcggcggcgcg Protospacer
* ********* ***.*********
276. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gcgcgacgtgctgaacgccggcggcttc Protospacer
.************** ******* .
277. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
tggacgcgtgctgagcggcggcggcggt Protospacer
... .********.*************
278. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gccagacgtgatgatcggcggcggcggg Protospacer
****** *** ************
279. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgtgatcgtgctgcacggcggcggcggc Protospacer
*. . ******* *************.
280. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtccgacgtgctgatcggcgtcggcgac Protospacer
*********** ***** *****..
281. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ggacgacgatctgaacggcggcggcacc Protospacer
.****** ***************. .
282. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP009827 (Xylella fastidiosa strain Pr8x plasmid pXF39, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ggtggacgtggtgaacggtggcggcgga Protospacer
. ****** *******.********
283. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP009825 (Xylella fastidiosa strain J1a12 plasmid pXF51-J1, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ggtggacgtggtgaacggtggcggcgga Protospacer
. ****** *******.********
284. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ggtcgaggtgctgaacggcggcgacgtc Protospacer
. *** ****************.** .
285. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NC_002490 (Xylella fastidiosa 9a5c plasmid pXF51, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ggtggacgtggtgaacggtggcggcgga Protospacer
. ****** *******.********
286. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
cgggcgcgtgctgagcggcggcggcgga Protospacer
*.. .********.************
287. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to NZ_CP009791 (Xylella fastidiosa strain U24d plasmid pXF51ud, complete sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
ggtggacgtggtgaacggtggcggcgga Protospacer
. ****** *******.********
288. spacer 1.1|1744756|28|NZ_CP009122|CRISPRCasFinder matches to JQ680373 (Unidentified phage clone 2209_scaffold64 genomic sequence) position: , mismatch: 7, identity: 0.75
caacgacgtgctgaacggcggcggcggt CRISPR spacer
gtatctggtgctgaaaggcggcggcggt Protospacer
*. ******** ************
289. spacer 1.2|1744810|28|NZ_CP009122|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.714
tgtcgacacgatgagtggcggggctggc CRISPR spacer
gcgcgacgcgatgagtggcggggcccag Protospacer
****.****************. .