Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP006738 Klebsiella pneumoniae HK787 chromosome, complete genome 1 crisprs RT,csa3,cas3,DEDDh,DinG,WYL 0 1 6 0

Results visualization

1. NZ_CP006738
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP006738_1 3962695-3962790 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP006738_1 1.1|3962725|36|NZ_CP006738|CRISPRCasFinder 3962725-3962760 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
NZ_CP006738_1 1.1|3962725|36|NZ_CP006738|CRISPRCasFinder 3962725-3962760 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
NZ_CP006738_1 1.1|3962725|36|NZ_CP006738|CRISPRCasFinder 3962725-3962760 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|3962725|36|NZ_CP006738|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|3962725|36|NZ_CP006738|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|3962725|36|NZ_CP006738|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1327254 : 1341976 18 Morganella_phage(50.0%) tail,integrase attL 1327007:1327027|attR 1347071:1347091
DBSCAN-SWA_2 1683963 : 1690868 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_3 2722872 : 2733759 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_4 2768967 : 2849377 88 Klebsiella_phage(20.93%) tail,portal,transposase,holin,capsid,protease,integrase,terminase,head attL 2794583:2794599|attR 2827340:2827356
DBSCAN-SWA_5 3440071 : 3449535 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_6 3929703 : 3973017 65 Salmonella_phage(35.29%) plate,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage