Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009559 Salmonella enterica subsp. enterica serovar Paratyphi A strain CMCC 50503 chromosome, complete genome 3 crisprs c2c9_V-U4,DEDDh,cas3,PD-DExK,WYL,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DinG 0 5 9 0

Results visualization

1. NZ_CP009559
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009559_1 2212109-2212209 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009559_2 2561698-2561909 TypeI-E I-E
3 spacers
cas3,cse2gr11,cas7,cas5,cas6e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009559_3 2578460-2578915 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009559_2 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT 2561849-2561880 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 112052-112083 5 0.844
NZ_CP009559_2 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT 2561849-2561880 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 224971-225002 5 0.844
NZ_CP009559_2 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT 2561849-2561880 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 90792-90823 5 0.844
NZ_CP009559_2 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT 2561849-2561880 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 271400-271431 6 0.812
NZ_CP009559_2 2.1|2561728|31|NZ_CP009559|PILER-CR 2561728-2561758 31 NZ_CP014208 Pantoea ananatis strain R100 plasmid, complete sequence 64395-64425 7 0.774
NZ_CP009559_2 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT 2561727-2561758 32 NZ_CP014208 Pantoea ananatis strain R100 plasmid, complete sequence 64395-64426 7 0.781
NZ_CP009559_2 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT 2561849-2561880 32 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 343727-343758 7 0.781
NZ_CP009559_2 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT 2561849-2561880 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 654402-654433 7 0.781
NZ_CP009559_2 2.1|2561728|31|NZ_CP009559|PILER-CR 2561728-2561758 31 NC_016817 Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence 2105-2135 8 0.742
NZ_CP009559_2 2.1|2561728|31|NZ_CP009559|PILER-CR 2561728-2561758 31 NZ_CP020944 Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence 2105-2135 8 0.742
NZ_CP009559_2 2.1|2561728|31|NZ_CP009559|PILER-CR 2561728-2561758 31 NC_017553 Pantoea ananatis PA13 plasmid PAGR_p, complete sequence 2205-2235 8 0.742
NZ_CP009559_2 2.1|2561728|31|NZ_CP009559|PILER-CR 2561728-2561758 31 NC_017533 Pantoea ananatis AJ13355 plasmid pEA320, complete sequence 108523-108553 8 0.742
NZ_CP009559_2 2.1|2561728|31|NZ_CP009559|PILER-CR 2561728-2561758 31 NZ_CP035036 Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence 264500-264530 8 0.742
NZ_CP009559_2 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT 2561849-2561880 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2052295-2052326 8 0.75
NZ_CP009559_2 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT 2561727-2561758 32 NC_017533 Pantoea ananatis AJ13355 plasmid pEA320, complete sequence 108523-108554 9 0.719
NZ_CP009559_2 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT 2561727-2561758 32 NC_016817 Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence 2104-2135 9 0.719
NZ_CP009559_2 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT 2561727-2561758 32 NZ_CP020944 Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence 2104-2135 9 0.719
NZ_CP009559_2 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT 2561727-2561758 32 NC_017553 Pantoea ananatis PA13 plasmid PAGR_p, complete sequence 2204-2235 9 0.719
NZ_CP009559_2 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT 2561727-2561758 32 NZ_CP035036 Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence 264500-264531 9 0.719
NZ_CP009559_2 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT 2561727-2561758 32 MH552514 Siphoviridae sp. isolate ctba45, complete genome 4692-4723 9 0.719
NZ_CP009559_3 3.6|2578794|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT 2578794-2578825 32 NZ_CP048637 Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence 43437-43468 9 0.719
NZ_CP009559_3 3.6|2578794|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT 2578794-2578825 32 NZ_CP048639 Rhizobium oryzihabitans strain M15 plasmid p7, complete sequence 54880-54911 9 0.719
NZ_CP009559_3 3.5|2578733|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT 2578733-2578764 32 NZ_CP019739 Lactobacillus brevis strain TMW 1.2108 plasmid pl12108-5, complete sequence 3689-3720 10 0.688
NZ_CP009559_3 3.5|2578733|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT 2578733-2578764 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 379454-379485 10 0.688

1. spacer 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

2. spacer 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

3. spacer 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gagatcgcgctggcggcctcatccg-tgccgca	Protospacer
*.**************.* ****** *****. 

4. spacer 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 6, identity: 0.812

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cagatcgcgctggcggcctcatccg-tgccgca	Protospacer
 .**************.* ****** *****. 

5. spacer 2.1|2561728|31|NZ_CP009559|PILER-CR matches to NZ_CP014208 (Pantoea ananatis strain R100 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774

attcttctctttcgttgaaaaacaggccatc	CRISPR spacer
acccttttctttcgttgaaaaacgggatatg	Protospacer
*..***.****************.** .** 

6. spacer 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP014208 (Pantoea ananatis strain R100 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781

aattcttctctttcgttgaaaaacaggccatc	CRISPR spacer
aacccttttctttcgttgaaaaacgggatatg	Protospacer
**..***.****************.** .** 

7. spacer 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 7, identity: 0.781

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
gggatcgcggtggcggtcgc-ttcgaggaagtt	Protospacer
********* ********** *.**  *  ** 

8. spacer 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 7, identity: 0.781

gggatcgcgctggcggtcgcatccgttgccgt-	CRISPR spacer
cggctcgcgctggcggtcgcttcc-tcggcgcg	Protospacer
 ** **************** *** *.* **. 

9. spacer 2.1|2561728|31|NZ_CP009559|PILER-CR matches to NC_016817 (Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence) position: , mismatch: 8, identity: 0.742

attcttctctttcgttgaaaaacaggccatc	CRISPR spacer
ccccttttctttcgttgaaaaacgggatatg	Protospacer
 ..***.****************.** .** 

10. spacer 2.1|2561728|31|NZ_CP009559|PILER-CR matches to NZ_CP020944 (Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence) position: , mismatch: 8, identity: 0.742

attcttctctttcgttgaaaaacaggccatc	CRISPR spacer
tcccttttctttcgttgaaaaacgggatatg	Protospacer
 ..***.****************.** .** 

11. spacer 2.1|2561728|31|NZ_CP009559|PILER-CR matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 8, identity: 0.742

attcttctctttcgttgaaaaacaggccatc	CRISPR spacer
ccccttttctttcgttgaaaaacgggatatg	Protospacer
 ..***.****************.** .** 

12. spacer 2.1|2561728|31|NZ_CP009559|PILER-CR matches to NC_017533 (Pantoea ananatis AJ13355 plasmid pEA320, complete sequence) position: , mismatch: 8, identity: 0.742

attcttctctttcgttgaaaaacaggccatc	CRISPR spacer
ccccttttctttcgttgaaaaacgggatatg	Protospacer
 ..***.****************.** .** 

13. spacer 2.1|2561728|31|NZ_CP009559|PILER-CR matches to NZ_CP035036 (Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

attcttctctttcgttgaaaaacaggccatc	CRISPR spacer
ccccttttctttcgttgaaaaacgggatatg	Protospacer
 ..***.****************.** .** 

14. spacer 2.5|2561849|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75

gggatcgcgctggcggtcgcatccgttgccgt	CRISPR spacer
cggctcgcgctcgcggtcgcatcctcggcccg	Protospacer
 ** ******* ************ . ***  

15. spacer 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NC_017533 (Pantoea ananatis AJ13355 plasmid pEA320, complete sequence) position: , mismatch: 9, identity: 0.719

aattcttctctttcgttgaaaaacaggccatc	CRISPR spacer
tccccttttctttcgttgaaaaacgggatatg	Protospacer
  ..***.****************.** .** 

16. spacer 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NC_016817 (Pantoea ananatis LMG 5342 plasmid pPANA10, complete sequence) position: , mismatch: 9, identity: 0.719

aattcttctctttcgttgaaaaacaggccatc	CRISPR spacer
tccccttttctttcgttgaaaaacgggatatg	Protospacer
  ..***.****************.** .** 

17. spacer 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP020944 (Pantoea ananatis strain PNA 97-1R plasmid unamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aattcttctctttcgttgaaaaacaggccatc	CRISPR spacer
ttcccttttctttcgttgaaaaacgggatatg	Protospacer
  ..***.****************.** .** 

18. spacer 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 9, identity: 0.719

aattcttctctttcgttgaaaaacaggccatc	CRISPR spacer
tccccttttctttcgttgaaaaacgggatatg	Protospacer
  ..***.****************.** .** 

19. spacer 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT matches to NZ_CP035036 (Pantoea ananatis strain NN08200 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aattcttctctttcgttgaaaaacaggccatc	CRISPR spacer
tccccttttctttcgttgaaaaacgggatatg	Protospacer
  ..***.****************.** .** 

20. spacer 2.3|2561727|32|NZ_CP009559|CRISPRCasFinder,CRT matches to MH552514 (Siphoviridae sp. isolate ctba45, complete genome) position: , mismatch: 9, identity: 0.719

aattcttctctttcgttgaaaaacaggccatc	CRISPR spacer
aattcttctctttttttgaaaaagatattctg	Protospacer
*************. ******** * ... * 

21. spacer 3.6|2578794|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719

cgattgcatcatcgcgcatagtgtcaaatgtc	CRISPR spacer
cgattgcatcctcgcgcatcgtggatcagcgc	Protospacer
********** ******** ***    *   *

22. spacer 3.6|2578794|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048639 (Rhizobium oryzihabitans strain M15 plasmid p7, complete sequence) position: , mismatch: 9, identity: 0.719

cgattgcatcatcgcgcatagtgtcaaatgtc	CRISPR spacer
cgattgcatcctcgcgcatcgtggatcagcgc	Protospacer
********** ******** ***    *   *

23. spacer 3.5|2578733|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019739 (Lactobacillus brevis strain TMW 1.2108 plasmid pl12108-5, complete sequence) position: , mismatch: 10, identity: 0.688

ctgtttagttaaatcgtcggcaaacgtaaacg	CRISPR spacer
tagtttagttagatagtcggcaaacaatccct	Protospacer
. *********.** **********.    * 

24. spacer 3.5|2578733|32|NZ_CP009559|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 10, identity: 0.688

ctgtttagttaaatcgtcggcaaacgtaaacg	CRISPR spacer
gcaaatgcgtaaattatcggcaaacgtaaacg	Protospacer
 ..  *.  *****..****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 256 : 7912 8 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_2 93160 : 102331 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_3 331388 : 337666 7 Salmonella_virus(50.0%) NA NA
DBSCAN-SWA_4 994201 : 1004875 13 Enterobacteria_phage(60.0%) integrase attL 980656:980672|attR 1006164:1006180
DBSCAN-SWA_5 2742270 : 2869123 128 Salmonella_phage(51.85%) terminase,lysis,portal,head,tRNA,integrase,holin,capsid,tail,plate attL 2741123:2741171|attR 2806933:2806981
DBSCAN-SWA_6 2945903 : 2990612 67 Salmonella_phage(51.52%) protease,terminase,portal,holin,integrase,lysis,coat attL 2948515:2948528|attR 2959810:2959823
DBSCAN-SWA_7 3546975 : 3556505 8 Dickeya_phage(16.67%) protease,integrase attL 3548226:3548240|attR 3561702:3561716
DBSCAN-SWA_8 3806668 : 3814861 8 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_9 4518021 : 4525248 7 Morganella_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage