Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010270 Paenibacillus polymyxa strain Sb3-1 plasmid pSb31l, complete sequence 0 crisprs DinG 0 0 0 0
NZ_CP010269 Paenibacillus polymyxa strain Sb3-1 plasmid pSb31s, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP010268 Paenibacillus polymyxa strain Sb3-1 chromosome, complete genome 2 crisprs DinG,csa3,DEDDh,WYL,cas3 0 1 5 0

Results visualization

1. NZ_CP010268
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010268_1 1949263-1949354 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010268_2 4063186-4063261 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010268_1 1.1|1949292|34|NZ_CP010268|CRISPRCasFinder 1949292-1949325 34 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 241829-241862 10 0.706

1. spacer 1.1|1949292|34|NZ_CP010268|CRISPRCasFinder matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

gccgggcccaccaggacctcccggacctgtgggg	CRISPR spacer
aagcggcctaccaggacatcccggacctggcgaa	Protospacer
.   ****.******** ***********  *..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 892442 : 901844 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_2 1389734 : 1408182 21 Bacillus_phage(37.5%) holin,plate,portal,tail NA
DBSCAN-SWA_3 1768126 : 1779575 9 Prochlorococcus_phage(25.0%) NA NA
DBSCAN-SWA_4 4975248 : 4982445 9 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 5410910 : 5418700 8 Bacillus_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage