Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP010520 Clostridium botulinum strain NCTC 8266 chromosome, complete genome 6 crisprs cas3,csa3,DEDDh,WYL,DinG 1 1 5 0

Results visualization

1. NZ_CP010520
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010520_1 367470-367567 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010520_2 1657999-1658287 Orphan II-B
4 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010520_3 1744755-1745511 Orphan II-B
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010520_4 2216760-2216882 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010520_5 2684430-2684524 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP010520_6 3150302-3150385 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP010520_3 3.6|1745115|36|NZ_CP010520|CRISPRCasFinder,CRT,PILER-CR 1745115-1745150 36 NZ_CP010520.1 961099-961134 0 1.0

1. spacer 3.6|1745115|36|NZ_CP010520|CRISPRCasFinder,CRT,PILER-CR matches to position: 961099-961134, mismatch: 0, identity: 1.0

tcaaacacttggagtttttacagatactataataat	CRISPR spacer
tcaaacacttggagtttttacagatactataataat	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP010520_2 2.1|1658029|34|NZ_CP010520|PILER-CR,CRISPRCasFinder,CRT 1658029-1658062 34 NZ_CP047113 Proteus mirabilis strain SCBX1.1 plasmid plas1.1.1, complete sequence 5294-5327 9 0.735
NZ_CP010520_2 2.1|1658029|34|NZ_CP010520|PILER-CR,CRISPRCasFinder,CRT 1658029-1658062 34 NZ_CP053900 Proteus mirabilis strain YPM35 plasmid pJPM35-2, complete sequence 24237-24270 9 0.735

1. spacer 2.1|1658029|34|NZ_CP010520|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047113 (Proteus mirabilis strain SCBX1.1 plasmid plas1.1.1, complete sequence) position: , mismatch: 9, identity: 0.735

tcatcacatacgttaaatatatttttaactacct	CRISPR spacer
actttgcatacggtaaaaatatttttaactatga	Protospacer
 * *..****** **** *************.  

2. spacer 2.1|1658029|34|NZ_CP010520|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053900 (Proteus mirabilis strain YPM35 plasmid pJPM35-2, complete sequence) position: , mismatch: 9, identity: 0.735

tcatcacatacgttaaatatatttttaactacct	CRISPR spacer
actttgcatacggtaaaaatatttttaactatga	Protospacer
 * *..****** **** *************.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 438757 : 491916 51 Clostridium_phage(23.08%) protease,coat,tRNA NA
DBSCAN-SWA_2 906887 : 929056 26 Clostridium_phage(75.0%) plate,tail NA
DBSCAN-SWA_3 1076723 : 1090477 11 Cyanophage(22.22%) NA NA
DBSCAN-SWA_4 1831661 : 1861190 35 Bacteriophage(28.57%) plate,capsid,tail,protease,tRNA NA
DBSCAN-SWA_5 1873386 : 1879926 11 Clostridium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage