Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP014509 Thermotoga caldifontis AZM44c09 2 crisprs csa3,RT,cas2,cas1,cas3,csc1gr5,csc2gr7,cas10d,WYL,cas6,DEDDh 0 1 1 0

Results visualization

1. NZ_AP014509
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014509_1 183968-184674 TypeI-D NA
9 spacers
RT,cas2,cas1,cas3,csc1gr5,csc2gr7,cas10d,WYL,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP014509_2 883908-885881 Orphan III-A
29 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP014509_2 2.24|885479|37|NZ_AP014509|PILER-CR,CRISPRCasFinder,CRT 885479-885515 37 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 600265-600301 11 0.703

1. spacer 2.24|885479|37|NZ_AP014509|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.703

acaggctgctggactcgctcaagcagcgcggtacaac	CRISPR spacer
tggtgctgctggactcgctgcagcagcgcgaggccgc	Protospacer
  . ***************  *********. .* .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1314814 : 1323184 8 Synechococcus_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage