Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP013355 Helicobacter pylori 26695-1CH 3 crisprs cas2,cas14j,DEDDh 0 1 1 0

Results visualization

1. NZ_AP013355
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP013355_1 350417-350543 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP013355_2 979907-980048 Orphan I-B
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP013355_3 1166183-1166271 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP013355_2 2.2|979995|23|NZ_AP013355|PILER-CR 979995-980017 23 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 183244-183266 3 0.87

1. spacer 2.2|979995|23|NZ_AP013355|PILER-CR matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 3, identity: 0.87

acgccagctttgataacgacacc	CRISPR spacer
gcgccagctttgatatcgacacg	Protospacer
.************** ****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1018090 : 1061737 36 Helicobacter_phage(50.0%) transposase,integrase,tRNA,protease attL 1037444:1037459|attR 1058010:1058025
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage