Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007152 Marinobacter salarius strain R9SW1 chromosome, complete genome 3 crisprs DEDDh,csa3,DinG,WYL,cas3 0 1 1 1

Results visualization

1. NZ_CP007152
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007152_1 1502069-1502158 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007152_2 3771283-3771384 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007152_3 4422917-4422996 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007152_3 3.1|4422943|28|NZ_CP007152|CRISPRCasFinder 4422943-4422970 28 NZ_CP021334 Marinobacter salarius strain HL2708#2 plasmid pHL2708Z5, complete sequence 138923-138950 0 1.0

1. spacer 3.1|4422943|28|NZ_CP007152|CRISPRCasFinder matches to NZ_CP021334 (Marinobacter salarius strain HL2708#2 plasmid pHL2708Z5, complete sequence) position: , mismatch: 0, identity: 1.0

taagagttcattccgagacgtcctgctg	CRISPR spacer
taagagttcattccgagacgtcctgctg	Protospacer
****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4492253 : 4605501 60 Enterobacteria_phage(33.33%) transposase,protease NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP007152.1|WP_052479578.1|4058716_4059034_-|hypothetical-protein 4058716_4059034_- 105 aa aa 93 NA NA No NA