1. spacer 8.13|1209676|19|NZ_CP009480|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
cgccggcggggccgggggc CRISPR spacer
cgccggcggggccgggggc Protospacer
*******************
2. spacer 8.13|1209676|19|NZ_CP009480|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 0, identity: 1.0
cgccggcggggccgggggc CRISPR spacer
cgccggcggggccgggggc Protospacer
*******************
3. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
4. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
5. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
6. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
7. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
8. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
9. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
10. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
11. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
12. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
13. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
14. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
15. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
16. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
17. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
18. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
19. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
20. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
21. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
22. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
23. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
24. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
25. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
26. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
27. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
28. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
29. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
30. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
31. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
32. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
33. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
34. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
35. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
36. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
37. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
38. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
39. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
40. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
41. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
42. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
43. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
44. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
45. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
46. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
47. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
48. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
gggcgggcggaccggggggcgc Protospacer
******* *************
49. spacer 8.15|1209760|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 2, identity: 0.909
gggcggggggaccggggggcgg CRISPR spacer
aggcgcggggaccggggggcgg Protospacer
.**** ****************
50. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
51. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
52. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
53. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
54. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
55. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
56. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
57. spacer 8.7|1209376|22|NZ_CP009480|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
58. spacer 8.11|1209559|22|NZ_CP009480|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
59. spacer 2.1|366216|27|NZ_CP009480|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
60. spacer 2.1|366216|27|NZ_CP009480|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
61. spacer 2.7|366612|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
62. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
63. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
64. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
65. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
66. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
67. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
68. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
69. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
70. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
71. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
72. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
73. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
74. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
75. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
76. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
77. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
78. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
79. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
80. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
81. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
82. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
83. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
84. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
85. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
86. spacer 2.1|366216|27|NZ_CP009480|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
87. spacer 2.1|366216|27|NZ_CP009480|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
88. spacer 2.7|366612|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
89. spacer 2.7|366612|27|NZ_CP009480|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
90. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
91. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
92. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
93. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
94. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
95. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
96. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
97. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
98. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
99. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
100. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
101. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
102. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
103. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
104. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
105. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
106. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
107. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
108. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
109. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
110. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
111. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
112. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
113. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
114. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
115. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
116. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
117. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
118. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
119. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
120. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
121. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
122. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
123. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
124. spacer 8.4|1209196|25|NZ_CP009480|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
125. spacer 9.2|1632875|27|NZ_CP009480|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
aagagcgctgagggcctggttgccggg Protospacer
* ***.***.***************
126. spacer 9.2|1632875|27|NZ_CP009480|CRT matches to NZ_CP030832 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750d, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
tgcggcgatgaaggccgggttgccggg Protospacer
* *** ******** **********
127. spacer 9.2|1632875|27|NZ_CP009480|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.815
acctgcgttgaaggcctggttgccggg CRISPR spacer
aagagcgctgagggcctggttgccggg Protospacer
* ***.***.***************
128. spacer 10.1|2041066|28|NZ_CP009480|CRISPRCasFinder matches to MF773750 (Mycobacterium phage OKCentral2016, complete genome) position: , mismatch: 5, identity: 0.821
cccccccccgcccccgccgaagatggta CRISPR spacer
acccccgccgcccccgccgaacatgttg Protospacer
***** ************** *** *.
129. spacer 10.1|2041066|28|NZ_CP009480|CRISPRCasFinder matches to JX307704 (Mycobacterium virus Goose, complete genome) position: , mismatch: 5, identity: 0.821
cccccccccgcccccgccgaagatggta CRISPR spacer
acccccgccgcccccgccgaacatgttg Protospacer
***** ************** *** *.
130. spacer 10.1|2041066|28|NZ_CP009480|CRISPRCasFinder matches to MT522002 (Mycobacterium phage Topanga, complete genome) position: , mismatch: 5, identity: 0.821
cccccccccgcccccgccgaagatggta CRISPR spacer
acccccgccgcccccgccgaacatgttg Protospacer
***** ************** *** *.
131. spacer 10.1|2041066|28|NZ_CP009480|CRISPRCasFinder matches to MN586021 (Arthrobacter phage Beagle, complete genome) position: , mismatch: 5, identity: 0.821
cccccccccgcccccgccgaagatggta CRISPR spacer
ctccccctcgccgccgccgaagatgctc Protospacer
*.*****.**** ************ *
132. spacer 10.1|2041066|28|NZ_CP009480|CRISPRCasFinder matches to MT889394 (Arthrobacter phage Odyssey395, complete genome) position: , mismatch: 5, identity: 0.821
cccccccccgcccccgccgaagatggta CRISPR spacer
ctccccctcgccgccgccgaagatgctc Protospacer
*.*****.**** ************ *
133. spacer 2.1|366216|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
134. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
135. spacer 2.7|366612|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
136. spacer 2.9|366762|27|NZ_CP009480|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
137. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
138. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
139. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
140. spacer 2.10|366822|27|NZ_CP009480|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
141. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
142. spacer 4.2|836474|34|NZ_CP009480|PILER-CR matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 6, identity: 0.824
ggcggggccgggctgatcggtgccggcggaggtc---- CRISPR spacer
ggcgtggccggcctgatcggtgcc----gaggtcttgg Protospacer
**** ****** ************ ******
143. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
144. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
145. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
146. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
147. spacer 9.2|1632875|27|NZ_CP009480|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778
acctgcgttgaaggcctggttgccggg CRISPR spacer
gcgcacgtcgaaggcctggttgccggc Protospacer
.* ..***.*****************
148. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
gacgcccccgtcaccggcgttgccgccgctt Protospacer
.******** ****** ***********..
149. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
gacgcccccgtcaccaccgttgccgccaccg Protospacer
.******** *****.***********..*.
150. spacer 2.4|366411|27|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
151. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
152. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
153. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
154. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
155. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
156. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
157. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
158. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
159. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
160. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
161. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
162. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
163. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
164. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
165. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
166. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
167. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
168. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
169. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
170. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
171. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
172. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
173. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
174. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
175. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
176. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
177. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
178. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
179. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
180. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
181. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
182. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
183. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
184. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
185. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
186. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
187. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
188. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
189. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
190. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
191. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
192. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
193. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
194. spacer 8.9|1209460|37|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
195. spacer 9.2|1632875|27|NZ_CP009480|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.741
acctgcgttgaaggcctggttgccggg CRISPR spacer
cggcgcgtagaaggcctggttgccgcc Protospacer
.**** ****************
196. spacer 11.3|2083710|30|NZ_CP009480|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
197. spacer 11.3|2083710|30|NZ_CP009480|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
198. spacer 11.3|2083710|30|NZ_CP009480|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
199. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *.************.**********
200. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccccttcaccgccgttgccgccgtca- CRISPR spacer
gacgccaccttcaccgcctttgcca-catcgc Protospacer
.***** *********** *****. *.**.
201. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_CP039696 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK21, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ccctcccccgccaccgccgttgccgccgccg Protospacer
* ***** .*****************.*.
202. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
gagccgcccttcaccgccgtcgccgccgacg Protospacer
.* * **************.******* *.
203. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_CP020695 (Sulfitobacter sp. D7 plasmid p1SUD7, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
gccgcccccttggccgccgttgccgtggcca Protospacer
. ********* .************. *.**
204. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccccttcaccgccgttgccgccgtca-- CRISPR spacer
cgcgcacccttcaccgtcgttgccg--ggcagc Protospacer
.*** **********.******** * **
205. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
206. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
207. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
208. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
209. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
210. spacer 4.2|836474|34|NZ_CP009480|PILER-CR matches to NZ_CP022416 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence) position: , mismatch: 8, identity: 0.765
ggcggggccgggctgatcggtgccggcggaggtc---- CRISPR spacer
cgcgaggacgggctgatcggtgcc----gaagtctata Protospacer
***.** **************** **.***
211. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
212. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
213. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
214. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
215. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
216. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
217. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
218. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
219. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
220. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
221. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
222. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
223. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
224. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
225. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
226. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
227. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
228. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
229. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
230. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
231. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
232. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
233. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
234. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
235. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
236. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
237. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
238. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
239. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
240. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
241. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
242. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
243. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
244. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
245. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
246. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
247. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
248. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
249. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
250. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
251. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
252. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
253. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
254. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
255. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
256. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
257. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
258. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
259. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
260. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
261. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
262. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
263. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
264. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
265. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
266. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
267. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
268. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
269. spacer 8.9|1209460|37|NZ_CP009480|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
270. spacer 11.3|2083710|30|NZ_CP009480|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
271. spacer 11.3|2083710|30|NZ_CP009480|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
272. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgccgccgccgtct Protospacer
.*. *.************..*********
273. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggtggcccctgcaccgccggtgccgccgttg Protospacer
...* ***** ******** *********..
274. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to MH338236 (Mycobacterium phage Ebony, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggcagcccctgcaccgccggtgccgccgttg Protospacer
..*. ***** ******** *********..
275. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NC_031262 (Mycobacterium phage Brocalys, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggtggcccctgcaccgccggtgccgccgttg Protospacer
...* ***** ******** *********..
276. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to MK524519 (Mycobacterium phage Salz, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggcagcccctgcaccgccggtgccgccgttg Protospacer
..*. ***** ******** *********..
277. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggtggcccctgcaccgccggtgccgccgttg Protospacer
...* ***** ******** *********..
278. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NC_004683 (Mycobacterium phage Che9c, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggtggcccctgcaccgccggtgccgccgttg Protospacer
...* ***** ******** *********..
279. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to MF140410 (Mycobacterium phage Et2Brutus, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggcagcccctgcaccgccggtgccgccgttg Protospacer
..*. ***** ******** *********..
280. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to AY129333 (Mycobacterium virus Che9c, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggtggcccctgcaccgccggtgccgccgttg Protospacer
...* ***** ******** *********..
281. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggtggcccctgcaccgccggtgccgccgttg Protospacer
...* ***** ******** *********..
282. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggtggcccctgcaccgccggtgccgccgttg Protospacer
...* ***** ******** *********..
283. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to MN892487 (Mycobacterium phage Mabel, complete genome) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ggcagcccctgcaccgccggtgccgccgttg Protospacer
..*. ***** ******** *********..
284. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
atgaccgccttcgccgccgttgccgccattc Protospacer
* .** *****.**************.*.
285. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . ****.*******.**********
286. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
cccgccgccttcagcgccgttgccggactcc Protospacer
**** ****** *********** **
287. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
atgaccgccttcgccgccgttgccgccattc Protospacer
* .** *****.**************.*.
288. spacer 15.7|3734492|31|NZ_CP009480|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccccttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgacgccgccgtct Protospacer
.*. *.************ .*********
289. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
290. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
291. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
292. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
293. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
294. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
295. spacer 3.1|691454|31|NZ_CP009480|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
296. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
297. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
298. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
299. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
300. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
301. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
302. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
303. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
304. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
305. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
306. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
307. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
308. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
309. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
310. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
311. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
312. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
313. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
314. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
315. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
316. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
317. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
318. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
319. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
320. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
321. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
322. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
323. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
324. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
325. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
326. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
327. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
328. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
329. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
330. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
331. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
332. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
333. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
334. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
335. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
336. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
337. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
338. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
339. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
340. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
341. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
342. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
343. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
344. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
345. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
346. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
347. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
348. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
349. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
350. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
351. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
352. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
353. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
354. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
355. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
356. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
357. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
358. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
359. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
360. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
361. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
362. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
363. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
364. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
365. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
366. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
367. spacer 8.9|1209460|37|NZ_CP009480|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
368. spacer 15.5|3734351|34|NZ_CP009480|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
369. spacer 15.5|3734351|34|NZ_CP009480|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
370. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
371. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
372. spacer 2.6|366546|33|NZ_CP009480|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
373. spacer 4.2|836474|34|NZ_CP009480|PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706
ggcggggccgggctgatcggtgccgg----cggaggtc CRISPR spacer
atcggggccgggcagaacggtgccgggctccagg---- Protospacer
. *********** ** ********* *.*.
374. spacer 4.2|836474|34|NZ_CP009480|PILER-CR matches to NZ_CP022212 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706
ggcggggccgggctgatcggtgccggcggaggtc CRISPR spacer
gcgccggccgtgctgatcggcgccggcggccgcg Protospacer
* ***** *********.******** *.
375. spacer 4.2|836474|34|NZ_CP009480|PILER-CR matches to NZ_CP022212 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706
ggcggggccgggctgatcggtgccggcggaggtc CRISPR spacer
gcgccggccgtgctgatcggcgccggcggccgcg Protospacer
* ***** *********.******** *.
376. spacer 4.2|836474|34|NZ_CP009480|PILER-CR matches to NZ_CP009320 (Burkholderia gladioli strain ATCC 10248 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggcggggccgggctgatcggtgccggcggaggtc CRISPR spacer
gcgccggccgtgctgatcggcgccggcggccgcg Protospacer
* ***** *********.******** *.
377. spacer 4.2|836474|34|NZ_CP009480|PILER-CR matches to NZ_CP009320 (Burkholderia gladioli strain ATCC 10248 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggcggggccgggctgatcggtgccggcggaggtc CRISPR spacer
gcgccggccgtgctgatcggcgccggcggccgcg Protospacer
* ***** *********.******** *.
378. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
379. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
380. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
381. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
382. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
383. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
384. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
385. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
386. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
387. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
388. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
389. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
390. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
391. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
392. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
393. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
394. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
395. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
396. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
397. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
398. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
399. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
400. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
401. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
402. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
403. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
404. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
405. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
406. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
407. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
408. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
409. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
410. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
411. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
412. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
413. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
414. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
415. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
416. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
417. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
418. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
419. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
420. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
421. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
422. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
423. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
424. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
425. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
426. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
427. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
428. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
429. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
430. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
431. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
432. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
433. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
434. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
435. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
436. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
437. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
438. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
439. spacer 8.9|1209460|37|NZ_CP009480|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
440. spacer 8.9|1209460|37|NZ_CP009480|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
441. spacer 13.9|3113009|35|NZ_CP009480|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
442. spacer 14.20|3116480|34|NZ_CP009480|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
443. spacer 15.5|3734351|34|NZ_CP009480|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
444. spacer 15.5|3734351|34|NZ_CP009480|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
445. spacer 15.5|3734351|34|NZ_CP009480|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
446. spacer 15.5|3734351|34|NZ_CP009480|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
447. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
448. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
449. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
450. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
451. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
452. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
453. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
454. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
455. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
456. spacer 8.5|1209244|40|NZ_CP009480|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
457. spacer 15.5|3734351|34|NZ_CP009480|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
458. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
459. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
460. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
461. spacer 8.3|1209139|34|NZ_CP009480|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*