Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009490 Yersinia pestis strain PBM19 plasmid pMT1, complete sequence 0 crisprs NA 0 0 3 0
NZ_CP009492 Yersinia pestis strain PBM19 chromosome, complete genome 7 crisprs cas7f,cas5f,cas8f,cas3f,cas1,cas3,DEDDh,DinG,csa3 5 11 11 1
NZ_CP009491 Yersinia pestis strain PBM19 plasmid pCD1, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP009489 Yersinia pestis strain PBM19 plasmid pPCP1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP009490
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 61567 73 Salmonella_phage(85.48%) transposase,terminase,tail NA
DBSCAN-SWA_2 75944 : 81712 5 Salmonella_phage(66.67%) integrase attL 75834:75847|attR 82146:82159
DBSCAN-SWA_3 86038 : 96097 5 Salmonella_phage(40.0%) tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP009492
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009492_1 11675-12183 TypeI-F I-F
8 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009492_2 330388-330600 Orphan I-F
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009492_3 457489-457610 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009492_4 1402807-1402886 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009492_5 2143185-2143296 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009492_6 2813168-2813568 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009492_7 3806129-3806459 Orphan I-F
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009492_1 1.7|12063|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12063-12094 32 NZ_CP009492.1 4413926-4413957 0 1.0
NZ_CP009492_1 1.8|12123|33|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12123-12155 33 NZ_CP009492.1 4408047-4408079 0 1.0
NZ_CP009492_7 7.1|3806157|33|NZ_CP009492|PILER-CR,CRISPRCasFinder,CRT 3806157-3806189 33 NZ_CP009492.1 4405675-4405707 0 1.0
NZ_CP009492_7 7.5|3806400|32|NZ_CP009492|CRISPRCasFinder,CRT 3806400-3806431 32 NZ_CP009492.1 4408362-4408393 0 1.0
NZ_CP009492_6 6.1|2813230|51|NZ_CP009492|PILER-CR 2813230-2813280 51 NZ_CP009492.1 2813117-2813167 1 0.98

1. spacer 1.7|12063|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to position: 4413926-4413957, mismatch: 0, identity: 1.0

aaaaagaatttgggattaaagttacccatcag	CRISPR spacer
aaaaagaatttgggattaaagttacccatcag	Protospacer
********************************

2. spacer 1.8|12123|33|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to position: 4408047-4408079, mismatch: 0, identity: 1.0

tcaatgcctgaatctctggcgtgatagctgcgg	CRISPR spacer
tcaatgcctgaatctctggcgtgatagctgcgg	Protospacer
*********************************

3. spacer 7.1|3806157|33|NZ_CP009492|PILER-CR,CRISPRCasFinder,CRT matches to position: 4405675-4405707, mismatch: 0, identity: 1.0

ccggcggtgatggcaattctacgtgggttcgtt	CRISPR spacer
ccggcggtgatggcaattctacgtgggttcgtt	Protospacer
*********************************

4. spacer 7.5|3806400|32|NZ_CP009492|CRISPRCasFinder,CRT matches to position: 4408362-4408393, mismatch: 0, identity: 1.0

agactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
agactgatgcaagatggcggtatgcgtacaga	Protospacer
********************************

5. spacer 6.1|2813230|51|NZ_CP009492|PILER-CR matches to position: 2813117-2813167, mismatch: 1, identity: 0.98

gtcaacgccactcattccacaaaatcccgcttcggcgggtttttgctttgg	CRISPR spacer
gtcaactccactcattccacaaaatcccgcttcggcgggtttttgctttgg	Protospacer
****** ********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009492_7 7.5|3806400|32|NZ_CP009492|CRISPRCasFinder,CRT 3806400-3806431 32 MT374852 Yersinia phage vB_YpM_3, complete genome 12-43 0 1.0
NZ_CP009492_2 2.4|330483|25|NZ_CP009492|PILER-CR 330483-330507 25 MT774386 CrAssphage cr110_1, complete genome 42860-42884 3 0.88
NZ_CP009492_2 2.4|330483|25|NZ_CP009492|PILER-CR 330483-330507 25 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86947-86971 3 0.88
NZ_CP009492_2 2.4|330483|25|NZ_CP009492|PILER-CR 330483-330507 25 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25854-25878 4 0.84
NZ_CP009492_2 2.4|330483|25|NZ_CP009492|PILER-CR 330483-330507 25 MK415408 CrAssphage GF1-2_000079F, complete genome 71109-71133 5 0.8
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK820641 Gordonia phage EnalisNailo, complete genome 34088-34119 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK878898 Gordonia phage Zameen, complete genome 34513-34544 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK919483 Gordonia phage Suscepit, complete genome 34514-34545 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK284520 Gordonia phage Lilas, complete genome 35799-35830 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK016492 Gordonia phage Bialota, complete genome 35265-35296 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK820642 Gordonia phage Polly, complete genome 33956-33987 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NC_041883 Gordonia phage Attis, complete genome 31646-31677 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK814755 Gordonia phage Antonio, complete genome 34513-34544 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK875796 Gordonia phage Tayonia, complete genome 34513-34544 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK801734 Gordonia phage LordFarquaad, complete genome 31627-31658 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 MK433274 Gordonia phage Bradissa, complete genome 34554-34585 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 KU963257 Gordonia phage Kita, complete genome 34522-34553 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NC_031251 Gordonia phage SoilAssassin, complete genome 31645-31676 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NC_031097 Gordonia phage Zirinka, complete genome 35253-35284 6 0.812
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 138555-138586 6 0.812
NZ_CP009492_1 1.1|11703|32|NZ_CP009492|CRISPRCasFinder,CRT 11703-11734 32 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69636-69667 7 0.781
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 JF974294 Aeromonas phage pIS4-A genomic sequence 21965-21996 7 0.781
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NC_021534 Vibrio phage pYD38-A genomic sequence 3299-3330 7 0.781
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 440819-440850 7 0.781
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 282870-282901 7 0.781
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 KJ433975 Mycobacterium phage 40BC, complete genome 23231-23262 7 0.781
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 KJ433973 Mycobacterium phage 39HC, complete genome 23231-23262 7 0.781
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NC_024145 Mycobacterium phage Hosp, complete genome 21427-21458 7 0.781
NZ_CP009492_2 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT 330476-330507 32 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86942-86973 7 0.781
NZ_CP009492_1 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12003-12034 32 NZ_CP024873 Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence 14979-15010 8 0.75
NZ_CP009492_1 1.7|12063|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12063-12094 32 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 1912-1943 8 0.75
NZ_CP009492_2 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT 330476-330507 32 NZ_CP010358 Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence 46720-46751 8 0.75
NZ_CP009492_2 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT 330476-330507 32 NC_019694 Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence 20911-20942 8 0.75
NZ_CP009492_2 2.5|330543|30|NZ_CP009492|PILER-CR 330543-330572 30 NC_018878 Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence 220250-220279 8 0.733
NZ_CP009492_1 1.2|11763|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11763-11794 32 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4006-4037 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 37586-37617 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 60831-60862 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 67671-67702 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 67672-67703 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 33435-33466 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 33830-33861 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 62769-62800 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 15616-15647 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 112580-112611 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 16858-16889 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 93734-93765 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 47570-47601 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 16520-16551 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 3287-3318 9 0.719
NZ_CP009492_1 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11823-11854 32 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 37637-37668 9 0.719
NZ_CP009492_2 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT 330476-330507 32 MT774386 CrAssphage cr110_1, complete genome 42858-42889 9 0.719
NZ_CP009492_2 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT 330476-330507 32 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25849-25880 9 0.719
NZ_CP009492_7 7.4|3806339|33|NZ_CP009492|PILER-CR,CRISPRCasFinder,CRT 3806339-3806371 33 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-955 9 0.727
NZ_CP009492_1 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 11883-11914 32 NZ_JX627581 Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence 30496-30527 10 0.688
NZ_CP009492_1 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12003-12034 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 815356-815387 11 0.656
NZ_CP009492_1 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12003-12034 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 820287-820318 11 0.656
NZ_CP009492_1 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12003-12034 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2180994-2181025 11 0.656
NZ_CP009492_1 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR 12003-12034 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2185925-2185956 11 0.656

1. spacer 7.5|3806400|32|NZ_CP009492|CRISPRCasFinder,CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

agactgatgcaagatggcggtatgcgtacaga	CRISPR spacer
agactgatgcaagatggcggtatgcgtacaga	Protospacer
********************************

2. spacer 2.4|330483|25|NZ_CP009492|PILER-CR matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 3, identity: 0.88

ttctttttgtcagcatctttaataa	CRISPR spacer
ttctttttatcagcatcttcaatag	Protospacer
********.**********.****.

3. spacer 2.4|330483|25|NZ_CP009492|PILER-CR matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 3, identity: 0.88

ttctttttgtcagcatctttaataa	CRISPR spacer
atctttttatcagcatcttttataa	Protospacer
 *******.*********** ****

4. spacer 2.4|330483|25|NZ_CP009492|PILER-CR matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 4, identity: 0.84

ttctttttgtcagcatctttaataa	CRISPR spacer
ttctttttgtcagcgtctgtaatgt	Protospacer
**************.*** ****. 

5. spacer 2.4|330483|25|NZ_CP009492|PILER-CR matches to MK415408 (CrAssphage GF1-2_000079F, complete genome) position: , mismatch: 5, identity: 0.8

ttctttttgtcagcatctttaataa	CRISPR spacer
agacttttatcagcatctttaataa	Protospacer
   .****.****************

6. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

7. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

8. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

9. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

10. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK016492 (Gordonia phage Bialota, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

11. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

12. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_041883 (Gordonia phage Attis, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

13. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

14. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

15. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK801734 (Gordonia phage LordFarquaad, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

16. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

17. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

18. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_031251 (Gordonia phage SoilAssassin, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

19. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_031097 (Gordonia phage Zirinka, complete genome) position: , mismatch: 6, identity: 0.812

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcga	Protospacer
 ***.* . ****** **********.******

20. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 6, identity: 0.812

tcgccattccgtgaacctgagcgcgttcgcga--	CRISPR spacer
tcgcctttccctgaacctga--gcgatcgtgacc	Protospacer
***** **** *********  *** ***.**  

21. spacer 1.1|11703|32|NZ_CP009492|CRISPRCasFinder,CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.781

tcaggggactggcgaacaatgtctttcatgat	CRISPR spacer
acgtcgcgctggcgaacaatctctttcatgat	Protospacer
 *.  * .************ ***********

22. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.781

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attacctgaatggcatttgctttatgcctgat	Protospacer
****.************* ****.   * ***

23. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.781

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attacctgaatggcatttgctttatgcctgat	Protospacer
****.************* ****.   * ***

24. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

----tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cacctcgc----tcgggaacctgggcgcgttcgcga	Protospacer
    ****    .** *******.************

25. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781

----tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cacctcgc----tcgggaacctgggcgcgttcgcga	Protospacer
    ****    .** *******.************

26. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

27. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

28. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 7, identity: 0.781

-tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcgc	Protospacer
 .****. .***** ***.************* 

29. spacer 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 7, identity: 0.781

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taataatctttttatcagcatcttttataatt	Protospacer
* * . *******.*********** **** *

30. spacer 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024873 (Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence) position: , mismatch: 8, identity: 0.75

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
ttactcaaacaagttgaggcgacgattctaaa	Protospacer
*.. ********.** ***********. * *

31. spacer 1.7|12063|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 8, identity: 0.75

aaaaagaatttgggattaaagttacccatcag	CRISPR spacer
taaaagcttttgggattaaagttattcaaaat	Protospacer
 *****  ****************..**  * 

32. spacer 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT matches to NZ_CP010358 (Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
gtgccatattttcgtcagcatcattaataaat	Protospacer
 *.   * ****.********* *********

33. spacer 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT matches to NC_019694 (Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
ttgatgctcttttggcagcttctttaataaat	Protospacer
**.*  ...***** **** ************

34. spacer 2.5|330543|30|NZ_CP009492|PILER-CR matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 8, identity: 0.733

ctgaaatacaaataaaataaatcgtcgaac	CRISPR spacer
atgaaataaaaataaaataaattatagtca	Protospacer
 ******* *************..* *   

35. spacer 1.2|11763|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gaaaaggtaagatgggcaagcttctagtagtt	CRISPR spacer
ttatgagaaagatgggcaagcttttagtggta	Protospacer
  * ..* ***************.****.** 

36. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

37. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

38. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

39. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

40. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

41. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

42. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

43. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

44. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat-----	CRISPR spacer
attatctgattggcagtttctttaac-----tgttta	Protospacer
********* ***** *******..*     *     

45. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

46. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

47. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

48. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

49. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

50. spacer 1.3|11823|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 9, identity: 0.719

attatctgaatggcattttctttggcgcagat	CRISPR spacer
attatctgattggcagtttctttaactgtttt	Protospacer
********* ***** *******..*     *

51. spacer 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
caagtttctttttatcagcatcttcaatagca	Protospacer
. *. ********.**********.****.  

52. spacer 2.2|330476|32|NZ_CP009492|CRISPRCasFinder,CRT matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taactttctttttgtcagcgtctgtaatgtgc	Protospacer
* *  **************.*** ****. ..

53. spacer 7.4|3806339|33|NZ_CP009492|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

ccgaaatcatcagatgtaattaagatttttgct	CRISPR spacer
aatggattatcagatgtaattaagtttttttcc	Protospacer
   ..**.**************** ***** *.

54. spacer 1.4|11883|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_JX627581 (Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence) position: , mismatch: 10, identity: 0.688

tcgccattccgtgaacctgagcgcgttcgcga	CRISPR spacer
ctaacgagccgtgaacctcagcgcattcgcgt	Protospacer
... *.  ********** *****.****** 

55. spacer 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

56. spacer 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

57. spacer 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

58. spacer 1.6|12003|32|NZ_CP009492|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 11, identity: 0.656

tcggtcaaacaaatttaggcgacgatttaaca	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccgctg	Protospacer
 .******************.* ** ... ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 126635 : 166966 34 Escherichia_phage(14.29%) coat,protease,transposase NA
DBSCAN-SWA_2 258365 : 322023 54 uncultured_virus(33.33%) transposase NA
DBSCAN-SWA_3 373042 : 417807 37 Escherichia_phage(22.22%) lysis,plate,tRNA,transposase NA
DBSCAN-SWA_4 683603 : 701968 19 Vibrio_phage(25.0%) plate,tail,coat,transposase NA
DBSCAN-SWA_5 816848 : 871990 55 Escherichia_phage(33.33%) integrase,protease,transposase attL 824323:824382|attR 870103:872059
DBSCAN-SWA_6 1491838 : 1567815 56 Escherichia_phage(33.33%) plate,transposase NA
DBSCAN-SWA_7 1695119 : 1744876 42 Escherichia_phage(30.0%) plate,tRNA,protease,transposase NA
DBSCAN-SWA_8 2464341 : 2515153 44 Bacillus_phage(25.0%) tRNA,protease,transposase NA
DBSCAN-SWA_9 3157740 : 3228435 56 uncultured_Mediterranean_phage(23.08%) tRNA,holin,transposase NA
DBSCAN-SWA_10 3439398 : 3499029 50 Escherichia_phage(54.55%) plate,tRNA,transposase NA
DBSCAN-SWA_11 4385625 : 4425672 48 Cronobacter_phage(15.79%) lysis,tail,integrase,transposase attL 4383977:4384007|attR 4425698:4425728
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP009492.1|WP_002430108.1|4417412_4417610_-|hypothetical-protein 4417412_4417610_- 65 aa aa NA NA NA 4385625-4425672 yes
3. NZ_CP009491
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26193 : 51548 20 Enterobacteria_phage(33.33%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage