Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP009704 Yersinia pestis strain Harbin35 chromosome, complete genome 6 crisprs cas3f,cas8f,cas5f,cas7f,cas6f,cas3,DEDDh,DinG,csa3 1 10 11 1
NZ_CP009701 Yersinia pestis strain Harbin35 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP009703 Yersinia pestis strain Harbin35 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP009702 Yersinia pestis strain Harbin35 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NZ_CP009704
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009704_1 162186-162395 TypeI-F I-F
3 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009704_2 1034909-1035118 Orphan I-F
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009704_3 1160055-1160176 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009704_4 1716378-1716647 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009704_5 2321749-2321828 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP009704_6 3332580-3332692 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP009704_4 4.1|1716406|32|NZ_CP009704|CRISPRCasFinder,CRT 1716406-1716437 32 NZ_CP009704.1 699659-699690 0 1.0

1. spacer 4.1|1716406|32|NZ_CP009704|CRISPRCasFinder,CRT matches to position: 699659-699690, mismatch: 0, identity: 1.0

tctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
tctgtacgcataccgccatcttgcatcagtct	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP009704_4 4.1|1716406|32|NZ_CP009704|CRISPRCasFinder,CRT 1716406-1716437 32 MT374852 Yersinia phage vB_YpM_3, complete genome 12-43 0 1.0
NZ_CP009704_1 1.3|162336|30|NZ_CP009704|CRISPRCasFinder 162336-162365 30 NZ_CP054046 Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence 2177-2206 3 0.9
NZ_CP009704_2 2.4|1035001|28|NZ_CP009704|PILER-CR 1035001-1035028 28 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86944-86971 5 0.821
NZ_CP009704_2 2.4|1035001|28|NZ_CP009704|PILER-CR 1035001-1035028 28 MT774386 CrAssphage cr110_1, complete genome 42860-42887 5 0.821
NZ_CP009704_1 1.3|162336|30|NZ_CP009704|CRISPRCasFinder 162336-162365 30 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69637-69666 6 0.8
NZ_CP009704_2 2.4|1035001|28|NZ_CP009704|PILER-CR 1035001-1035028 28 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25851-25878 6 0.786
NZ_CP009704_1 1.1|162216|30|NZ_CP009704|CRISPRCasFinder 162216-162245 30 NZ_CP013487 Vibrio alginolyticus strain ATCC 33787 plasmid pMBL287, complete sequence 166773-166802 7 0.767
NZ_CP009704_1 1.2|162276|30|NZ_CP009704|CRISPRCasFinder 162276-162305 30 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4007-4036 7 0.767
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NC_021534 Vibrio phage pYD38-A genomic sequence 3299-3329 7 0.774
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 JF974294 Aeromonas phage pIS4-A genomic sequence 21966-21996 7 0.774
NZ_CP009704_1 1.6|162336|31|NZ_CP009704|CRT 162336-162366 31 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69637-69667 7 0.774
NZ_CP009704_2 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT 1034997-1035028 32 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 86942-86973 7 0.781
NZ_CP009704_2 2.4|1035001|28|NZ_CP009704|PILER-CR 1035001-1035028 28 MK415408 CrAssphage GF1-2_000079F, complete genome 71106-71133 7 0.75
NZ_CP009704_1 1.3|162336|30|NZ_CP009704|CRISPRCasFinder 162336-162365 30 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 43412-43441 8 0.733
NZ_CP009704_1 1.5|162276|31|NZ_CP009704|PILER-CR,CRT 162276-162306 31 NZ_CP031943 Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence 4007-4037 8 0.742
NZ_CP009704_2 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT 1034997-1035028 32 NZ_CP010358 Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence 46720-46751 8 0.75
NZ_CP009704_2 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT 1034997-1035028 32 NC_019694 Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence 20911-20942 8 0.75
NZ_CP009704_1 1.2|162276|30|NZ_CP009704|CRISPRCasFinder 162276-162305 30 AP014500 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C79, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 26487-26516 9 0.7
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 37586-37616 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 60831-60861 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP021340 Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence 67671-67701 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP021336 Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence 67672-67702 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 33830-33860 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 62769-62799 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 15616-15646 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 112580-112610 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 16858-16888 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 47570-47600 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 16520-16550 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 3287-3317 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 37637-37667 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 33436-33466 9 0.71
NZ_CP009704_1 1.4|162216|31|NZ_CP009704|PILER-CR,CRT 162216-162246 31 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 93735-93765 9 0.71
NZ_CP009704_2 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT 1034997-1035028 32 MT774386 CrAssphage cr110_1, complete genome 42858-42889 9 0.719
NZ_CP009704_2 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT 1034997-1035028 32 NZ_CP028934 Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence 25849-25880 9 0.719
NZ_CP009704_4 4.2|1716466|33|NZ_CP009704|CRISPRCasFinder,CRT,PILER-CR 1716466-1716498 33 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-955 9 0.727

1. spacer 4.1|1716406|32|NZ_CP009704|CRISPRCasFinder,CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

tctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
tctgtacgcataccgccatcttgcatcagtct	Protospacer
********************************

2. spacer 1.3|162336|30|NZ_CP009704|CRISPRCasFinder matches to NZ_CP054046 (Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.9

tcatgaaagacattgttcgccagtcccctg	CRISPR spacer
tcatgaaagacattgtgcgccagtcacccg	Protospacer
**************** ******** **.*

3. spacer 2.4|1035001|28|NZ_CP009704|PILER-CR matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 5, identity: 0.821

aagttctttttgtcagcatctttaataa	CRISPR spacer
ataatctttttatcagcatcttttataa	Protospacer
* . *******.*********** ****

4. spacer 2.4|1035001|28|NZ_CP009704|PILER-CR matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 5, identity: 0.821

aagttctttttgtcagcatctttaataa	CRISPR spacer
agtttctttttatcagcatcttcaatag	Protospacer
*. ********.**********.****.

5. spacer 1.3|162336|30|NZ_CP009704|CRISPRCasFinder matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 6, identity: 0.8

tcatgaaagacattgttcgccagtcccctg	CRISPR spacer
tcatgaaagagattgttcgccagcgcgacg	Protospacer
********** ************. *  .*

6. spacer 2.4|1035001|28|NZ_CP009704|PILER-CR matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 6, identity: 0.786

aagttctttttgtcagcatctttaataa	CRISPR spacer
actttctttttgtcagcgtctgtaatgt	Protospacer
*  **************.*** ****. 

7. spacer 1.1|162216|30|NZ_CP009704|CRISPRCasFinder matches to NZ_CP013487 (Vibrio alginolyticus strain ATCC 33787 plasmid pMBL287, complete sequence) position: , mismatch: 7, identity: 0.767

tctgcgccaaagaaaatgccattcagataa	CRISPR spacer
tctgtgccaaagaaaatgccactgaacaag	Protospacer
****.****************.* *.  *.

8. spacer 1.2|162276|30|NZ_CP009704|CRISPRCasFinder matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

actactagaagcttgcccatcttacctttt	CRISPR spacer
accactaaaagcttgcccatctttctcata	Protospacer
**.****.*************** *.. * 

9. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 7, identity: 0.774

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
tcaggcataaagcaaatgccattcaggtaat	Protospacer
** *   .**** *************.****

10. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 7, identity: 0.774

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
tcaggcataaagcaaatgccattcaggtaat	Protospacer
** *   .**** *************.****

11. spacer 1.6|162336|31|NZ_CP009704|CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.774

tcatgaaagacattgttcgccagtcccctga	CRISPR spacer
tcatgaaagagattgttcgccagcgcgacgt	Protospacer
********** ************. *  .* 

12. spacer 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 7, identity: 0.781

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taataatctttttatcagcatcttttataatt	Protospacer
* * . *******.*********** **** *

13. spacer 2.4|1035001|28|NZ_CP009704|PILER-CR matches to MK415408 (CrAssphage GF1-2_000079F, complete genome) position: , mismatch: 7, identity: 0.75

aagttctttttgtcagcatctttaataa	CRISPR spacer
ataagacttttatcagcatctttaataa	Protospacer
* .   .****.****************

14. spacer 1.3|162336|30|NZ_CP009704|CRISPRCasFinder matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

tcatgaaagacattgttcgccagtcccctg	CRISPR spacer
tcatgaaagacattgttcgacaaaaaacac	Protospacer
******************* **.    *  

15. spacer 1.5|162276|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP031943 (Nostoc sphaeroides strain Kutzing En plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

actactagaagcttgcccatcttaccttttc	CRISPR spacer
accactaaaagcttgcccatctttctcataa	Protospacer
**.****.*************** *.. *  

16. spacer 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT matches to NZ_CP010358 (Acinetobacter johnsonii XBB1 plasmid pXBB1-8, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
gtgccatattttcgtcagcatcattaataaat	Protospacer
 *.   * ****.********* *********

17. spacer 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT matches to NC_019694 (Oscillatoria acuminata PCC 6304 plasmid pOSCIL6304.02, complete sequence) position: , mismatch: 8, identity: 0.75

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
ttgatgctcttttggcagcttctttaataaat	Protospacer
**.*  ...***** **** ************

18. spacer 1.2|162276|30|NZ_CP009704|CRISPRCasFinder matches to AP014500 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S32-C79, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 9, identity: 0.7

actactagaagcttgcccatcttacctttt	CRISPR spacer
attactagaagcttgcacatcttctacaac	Protospacer
*.************** ****** . .  .

19. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

20. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

21. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP021340 (Escherichia coli strain 95NR1 plasmid p95NR1A, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

22. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP021336 (Escherichia coli strain 95JB1 plasmid p95JB1A, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

23. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

24. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

25. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

26. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

27. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

28. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

29. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

30. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

31. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

32. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

33. spacer 1.4|162216|31|NZ_CP009704|PILER-CR,CRT matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 9, identity: 0.71

tctgcgccaaagaaaatgccattcagataat	CRISPR spacer
aaacagttaaagaaactgccaatcagataat	Protospacer
     *..******* ***** *********

34. spacer 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT matches to MT774386 (CrAssphage cr110_1, complete genome) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
caagtttctttttatcagcatcttcaatagca	Protospacer
. *. ********.**********.****.  

35. spacer 2.2|1034997|32|NZ_CP009704|CRISPRCasFinder,CRT matches to NZ_CP028934 (Campylobacter jejuni strain FORC_083 plasmid pFORC_083_2, complete sequence) position: , mismatch: 9, identity: 0.719

ttaagttctttttgtcagcatctttaataaat	CRISPR spacer
taactttctttttgtcagcgtctgtaatgtgc	Protospacer
* *  **************.*** ****. ..

36. spacer 4.2|1716466|33|NZ_CP009704|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

agcaaaaatcttaattacatctgatgatttcgg	CRISPR spacer
ggaaaaaaacttaattacatctgataatccatt	Protospacer
.* ***** ****************.**..   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 568503 : 715660 140 Escherichia_phage(11.48%) lysis,tRNA,transposase,tail,protease,holin,coat NA
DBSCAN-SWA_2 1077590 : 1148322 48 Indivirus(12.5%) transposase,plate,tRNA,lysis NA
DBSCAN-SWA_3 1179883 : 1253211 51 Escherichia_phage(20.0%) transposase,tRNA,protease NA
DBSCAN-SWA_4 1396660 : 1404980 10 Shigella_phage(33.33%) coat,tail,plate NA
DBSCAN-SWA_5 1867053 : 1922972 50 uncultured_Mediterranean_phage(20.0%) transposase,tRNA,holin NA
DBSCAN-SWA_6 2395971 : 2461121 46 Yellowstone_lake_phycodnavirus(28.57%) transposase,plate,tRNA NA
DBSCAN-SWA_7 2611089 : 2651015 28 Escherichia_phage(25.0%) transposase,plate,tRNA NA
DBSCAN-SWA_8 2673510 : 2735947 56 uncultured_Mediterranean_phage(18.18%) transposase,tail,protease NA
DBSCAN-SWA_9 3615692 : 3678360 60 Bacillus_phage(20.0%) transposase,protease,tRNA NA
DBSCAN-SWA_10 4151739 : 4217312 60 Escherichia_phage(20.0%) transposase,tRNA,integrase,protease attL 4151630:4151689|attR 4216744:4217461
DBSCAN-SWA_11 4438755 : 4508692 58 Escherichia_phage(46.15%) transposase,plate,tRNA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP009704.1|WP_002214494.1|671318_671675_-|hypothetical-protein 671318_671675_- 118 aa aa NA NA NA 568503-715660 yes
2. NZ_CP009702
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 494 : 59507 63 Salmonella_phage(91.53%) transposase,terminase,tail NA
DBSCAN-SWA_2 76493 : 83891 9 Escherichia_phage(37.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP009703
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 26940 : 50342 20 Yersinia_phage(40.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage